45 resultados para Antisense oligonucleotide
em Repositório Institucional UNESP - Universidade Estadual Paulista "Julio de Mesquita Filho"
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Short-term cold exposure of homeothermic animals leads to higher thermogenesis and food consumption accompanied by weight loss. An analysis of cDNA-macroarray was employed to identify candidate mRNA species that encode proteins involved in thermogenic adaptation to cold. A cDNA-macroarray analysis, confirmed by RT-PCR, immunoblot, and RIA, revealed that the hypothalamic expression of melanin-concentrating hormone (MCH) is enhanced by exposure of rats to cold environment. The blockade of hypothalamic MCH expression by antisense MCH oligonucleotide in cold-exposed rats promoted no changes in feeding behavior and body temperature. However, MCH blockade led to a significant drop in body weight, which was accompanied by decreased liver glycogen, increased relative body fat, increased absolute and relative interscapular brown adipose tissue mass, increased uncoupling protein 1 expression in brown adipose tissue, and increased consumption of lean body mass. Thus, increased hypothalamic MCH expression in rats exposed to cold may participate in the process that allows for efficient use of energy for heat production during thermogenic adaptation to cold.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Introduction: Inflammatory bowel disease (IBD) consists of Crohn's disease, ulcerative colitis and an unspecific IBD. The unclear etiology of IBD is a limiting factor that complicates the development of new pharmacological treatments and explains the high frequency of refractory patients to current drugs, including both conventional and biological therapies. In view of this, recent progress on the development of novel patented products to treat IBD was reviewed.Areas covered: Evaluation of the patent literature during the period 2013 - 2014 focused on chemical compounds, functional foods and biological therapy useful for the treatment of IBD.Expert opinion: Majority of the patents are not conclusive because they were based on data from unspecific methods not related to intestinal inflammation and, when related to IBD models, few biochemical and molecular evaluations that could be corroborating their use in human IBD were presented. On the other hand, methods and strategies using new formulations of conventional drugs, guanylyl cyclase C peptide agonists, compounds that influence anti-adhesion molecules, mAbs anti-type I interferons and anti-integrin, oligonucleotide antisense Smad7, growth factor neuregulin 4 and functional foods, particularly fermented wheat germ with Saccharomyces cerevisiae, are promising products for use in the very near future.
Resumo:
Fluorescence amplified fragment length polymorphism (fAFLP) was used to assess the genetic relatedness of 40 Staphylococcus aureus strains isolated from human and animal skin samples in seven dairy farms with manual milking. S. aureus was isolated from 11 out of 30 (36%) human skin samples and from 29 out of 100 (29%) teat skin samples from apparently healthy cows. Genomic DNA from each isolate was double-digested with EcoRI and MseI and complementary oligonucleotide adaptors were ligated to the restriction fragments. Pre-selective and selective, amplification reactions were performed, the amplified fragments were separated by electrophoresis in an ABI377 sequencer and analysed using GeneScan 3.1 and Genotyper 2.5. Three single isolates (a-c), a predominant cluster with 35 isolates (d) and another cluster with two isolates (e) were identified. Both clusters d and e included human and animal isolates genetically related, because the profiles had 90-100% homology. Since no cluster was comprised uniquely of human or animal isolates and given the close genetic relatedness among human and animal samples in the farms, the present findings support the. hypothesis that dairy workers can spread S. aureus through manual milking. (C) 2005 Elsevier B.V. All rights reserved.
Molecular analysis of the bacterial diversity in a specialized consortium for diesel oil degradation
Resumo:
Diesel oil is a compound derived from petroleum, consisting primarily of hydrocarbons. Poor conditions in transportation and storage of this product can contribute significantly to accidental spills causing serious ecological problems in soil and water and affecting the diversity of the microbial environment. The cloning and sequencing of the 16S rRNA gene is one of the molecular techniques that allows estimation and comparison of the microbial diversity in different environmental samples. The aim of this work was to estimate the diversity of microorganisms from the Bacteria domain in a consortium specialized in diesel oil degradation through partial sequencing of the 16S rRNA gene. After the extraction of DNA metagenomics, the material was amplified by PCR reaction using specific oligonucleotide primers for the 16S rRNA gene. The PCR products were cloned into a pGEM-T-Easy vector (Promega), and Escherichia coli was used as the host cell for recombinant DNAs. The partial clone sequencing was obtained using universal oligonucleotide primers from the vector. The genetic library obtained generated 431 clones. All the sequenced clones presented similarity to phylum Proteobacteria, with Gammaproteobacteria the most present group (49.8 % of the clones), followed by Alphaproteobacteira (44.8 %) and Betaproteobacteria (5.4 %). The Pseudomonas genus was the most abundant in the metagenomic library, followed by the Parvibaculum and the Sphingobium genus, respectively. After partial sequencing of the 16S rRNA, the diversity of the bacterial consortium was estimated using DOTUR software. When comparing these sequences to the database from the National Center for Biotechnology Information (NCBI), a strong correlation was found between the data generated by the software used and the data deposited in NCBI.
Resumo:
A semi-nested reverse transcription-polymerase chain reaction (Semi-N-RT-PCR) was developed and used to detect the S glycoprotein gene of infectious bronchitis virus (IBV) strains and to discriminate H120 vaccine strain from other strains. Viral RNA was extracted from the allantoic fluid of chicken embryos and from tissues of chickens experimentally infected with different strains of IBV. Amplification and identification of the viral RNA was performed using two sets of primers complementary to a region of the S glycoprotein gene in the Semi-N-RT-PCR assay. The pair of primers used in the first PCR consisted of universal oligonucleotides flanking a more variable region of S1-S2 gene. The second primer pair was used in the Semi-N-RT-PCR and was comprised of one of the primers from the first universal pair together with either another universal internal oligolucleotide or a oligonucleotide sequence specific for the H120 strain of IBV. The universal primers detected all reference IBV strains and field isolates tested herein. The Semi-N-RT-PCR had high sensitivity and specificity, and was able to differentiate the H120 vaccine strain from other reference IBV strains; including M41 strain. All tissue samples collected from chickens experimentally infected with H120 or M41 strains were positive in the semi-nested RT-PCR using universal primers, while only the H120-infected tissue samples were amplified by the set of primers containing the H120-oligonucleotide. In conclusion, the ability of Semi-N-RT-PCR to detect distinct IBV strains and preliminarily discriminate the vaccine strain (H120) closes a diagnostic gap and offers the opportunity to use comprehensive PCR procedures for the IBV diagnosis.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
The survey presented here describes the bacterial diversity and community structures of a pristine forest soil and an anthropogenic, terra preta from the Western Amazon forest using molecular methods to identify the predominant phylogenetic groups. Bacterial community similarities and species diversity in the two soils were compared using oligonucleotide fingerprint grouping of 16S rRNA gene sequences for 1500 clones (OFRG) and by DNA sequencing. The results showed that both soils had similar bacterial community compositions over a range of phylogenetic distances, among which Acidobacteria were predominant, but that terra preta supported approximately 25% greater species richness. The survey provides the first detailed analysis of the composition and structure of bacterial communities from terra preta anthrosols using noncultured-based molecular methods. (c) 2006 Elsevier Ltd. All rights reserved.
Resumo:
O objetivo deste trabalho foi desenvolver um oligonucleotídeo iniciador para reação em cadeia da polimerase (PCR) específico para as estirpes de Xylella fastidiosa que causam o mal de Pierce (PD) em videira (Vitis vinifera). Amplificações de DNA de 23 diferentes hospedeiros, usando o conjunto de oligonucleotídeos REP1-R (5'-IIIICGICGIATCCIGGC-3') e REP 2 (5'-ICGICTTATCI GGCCTAC-3') utilizando o programa: 94 ºC/2 min; 35 X (94 ºC/1 min, 45 ºC/1 min; 72 ºC/1 min and 30 s) 72 ºC/5 min, produziu um fragmento de 630 pb que diferenciou as estirpes de videiras dos demais. Entretanto, padrões de bandeamento REP não são considerados confiáveis para detecção devido ao par de oligonucleotídeos REP 1 e REP 2 corresponderem a seqüências repetitivas encontradas por todo o genoma bacteriano. Desse modo, o produto amplificado de 630 pb foi eluído do gel de agarose, purificado e seqüenciado. A informação da seqüência nucleotídica foi usada para identificar e sintetizar um oligonucleotídeo específico para o isolado de X. fastidiosa causadora do mal de Pierce denominado Xf-1 (5'-CGGGGGTGTAGGAGGGGTTGT-3'), que foi utilizado juntamente com o oligonucleotídeo REP-2 nas condições 94 ºC/2 min; 35 X (94 ºC/1 min, 62 ºC/1 min; 72 ºC/1 min and 30 s) 72 ºC/10 min. Os DNAs das estirpes de X. fastidiosa de outros hospedeiros [amêndoa (Prumus amygdalus), citros (Citrus spp.), café (Coffea arabica), olmo (Ulmus americana), amora (Morus rubra), carvalho (Quercus rubra), vinca (Catharantus roseus), ameixa (Prunus salicina) e ragweed (Ambrosia artemisiifolia)] e de bactérias Gram negativas e positivas foram submetidos a amplificação com o conjunto de oligonucleotídeos Xf-1/REP 2. Um fragmento, de aproximadamente 350 pb, foi amplificado apenas com o DNA de X. fastidiosa isolada de videira.
Resumo:
Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.
Resumo:
The piezoelectric quartz crystal resonators modified with oligonucleotide probes were used for detection of hepatitis C virus (HCV) in serum. The gold electrodes on either rough or smooth surface crystals were modified with a self-assembled monolayer of cystamine. After activation with glutaraldehyde, either avidin or streptavidin were immobilized and used for attachment of biotinylated DNA probes (four different sequences). Piezoelectric biosensors were used in a flow-through setup for direct monitoring of DNA resulting from the reverse transcriptase-linked polymerase chain reaction (RT-PCR) amplification of the original viral RNA. The samples of patients with hepatitis C were analyzed and the results were compared with the standard RT-PCR procedure (Amplicor test kit of Roche, microwell format with spectrophotometric evaluation). The piezoelectric hybridization assay was completed in 10 min and the same sensing surface was suitable for repeated use. (C) 2004 Elsevier B.V. All rights reserved.
Resumo:
Recent advances have accelerated the development of biosensors for the analysis of specific gene sequences. In this kind of biosensor, a DNA probe is immobilized on a transducer and the hybridization with the target DNA is monitored by suitable methodology. In the present work, the streptavidin (STA) was encapsulated in thin films siloxane-poly(propylene oxide) hybrids prepared by sol-gel method and deposited on the graphite electrode surface by dip-coating process. Biotinylated 18-mer probes were immobilized through STA and a novel amperometric DNA biosensor for the detection and genotyping of the hepatitis C virus (genotypes 1, 2A/C, 2B and 3) is described. The HCV RNA from serum was submitted to reverse transcriptase-linked polymerase chain reaction (RT-PCR) and biotin-labeled cDNA was obtained. Thus, the cDNA was hybridized to the target-specific oligonucleotide probe immobilized on the graphite electrode surface and following the avidin-peroxidase conjugate was added. The enzymatic response was investigated by constant potential amperometry at -0.45 V versus Ag/AgCl using H2O2 and KI solutions. HCV RNA negative and positive controls and positive samples of sera patients were analyzed and the results were compared to commercial kit. The proposed methodology appeared to be suitable and convenient tool for streptavidin immobilization and diagnose of HCV disease. (c) 2006 Elsevier B.V. All rights reserved.
Resumo:
INTRODUÇÃO: As hemoglobinopatias resultam de alterações hereditárias, sendo prevalentes em muitas regiões do mundo, mas atingem a população brasileira de forma significativa. Elas são decorrentes de alterações em genes estruturais responsáveis pelo aparecimento das hemoglobinas variantes e/ou em genes reguladores, resultando nas talassemias. A identificação dessas patologias tem sido rotineiramente realizada por procedimentos eletroforéticos, contudo nossa experiência laboratorial evidencia que as mesmas nem sempre apresentam resoluções suficientes para a correta caracterização da mutação. CASUÍSTICAS E MÉTODOS: O propósito deste trabalho foi estabelecer uma metodologia válida para a caracterização das hemoglobinas S, C e D em homozigose ou heterozigose, e suas possíveis interações, baseada na amplificação gênica alelo-específica (PCR-AE) com a utilização de primers sense, antisense e primers que se acoplam na posição do alelo mutante e na respectiva posição do alelo normal. RESULTADOS E DISCUSSÃO: Os resultados evidenciaram a validade dessa metodologia na caracterização das mutações, sendo esse procedimento de fácil realização, reprodutível e possível de ser aplicado em um significativo número de amostras.
Resumo:
The binding selectivity of the M(phen)(edda) (M = Cu, Co, Ni, Zn; phen = 1,10-phenanthroline, edda = ethylenediaminediacetic acid) complexes towards ds(CG)(6), ds(AT)(6) and ds(CGCGAATTCGCG) B-form oligonucleotide duplexes were studied by CD spectroscopy and molecular modeling. The binding mode is intercalation and there is selectivity towards AT-sequence and stacking preference for A/A parallel or diagonal adjacent base steps in their intercalation. The nucleolytic properties of these complexes were investigated and the factors affecting the extent of cleavage were determined to be: concentration of complex, the nature of metal(11) ion, type of buffer, pH of buffer, incubation time, incubation temperature, and the presence of hydrogen peroxide or ascorbic acid as exogenous reagents. The fluorescence property of these complexes and its origin were also investigated. The crystal structure of the Zn(phen)(edda) complex is reported in which the zinc atom displays a distorted trans-N4O2 octahedral geometry; the crystal packing features double layers of complex molecules held together by extensive hydrogen bonding that inter-digitate with adjacent double layers via pi...pi interactions between 1,10-phenanthroline residues. The structure is compared with that of the recently described copper(II) analogue and, with the latter, included in molecular modeling. (C) 2008 Elsevier B.V. All rights reserved.