Electrochemical measurements of oligonucleotides in the presence of chromosomal DNA using membrane-covered carbon electrodes

Substantial improvements in the selectivity of electrochemical measurements of trace nucleic adds are obtained by using membrane-covered carbon disk electrodes. Access to the electrode surface can be manipulated via a judicious choice of the membrane molecular weight cutoff (MWCO). The resulting separation step, performed in situ at the electrode surface, adds a new dimension of selectivity based on molecular size to electroanalysis of nucleic acids, Transport properties are evaluated with respect to the oligonucleotide length and membrane MWCO. A highly selective response is observed for synthetic oligonucleotides in the presence of otherwise interfering chromosomal DNAs. Discrimination among oligonucleotides of different lengths is also possible, Short accumulation periods (1-5 min) are sufficient for convenient measurements of low milligram per liter concentrations.

Caracterização molecular de isolados de Flavobacterium columnare de tilapia do nilo e piracanjuba por meio de RAPD-PCR

Flavobacterium columnare is a cosmopolite bacteria and it is one of the main problem in Brazilian aquaculture, causing high mortalities index and economic damage. The main factors that contribute to columnaris disease are inadequate water quality, excess handling, high density of fish and temperature variations. For a successful epidemiological study and disease control, it is essential to differentiate the F. columnare from other yellow pigmentation bacteria. The present study used molecular techniques to characterize, by RAPD-PCR, two strains of F. columnare isolated from Oreochromis niloticus and Brycon orbignyanus. Data were analyzed as binary (0 and 1) and a genetic similarity matrix was generated by Jaccard's coefficient. Cluster analysis was performed by the neighbor joining method. The RAPD-PCR technique confirmed to be a usefull tool to obtain genetic profiles from F. columnare isolates based on the oligonucleotides used and to verify genetic similarity.

Infectious bronchitis virus: detection and vaccine Strain differentiation by semi-nested RT-PCR

A semi-nested reverse transcription-polymerase chain reaction (Semi-N-RT-PCR) was developed and used to detect the S glycoprotein gene of infectious bronchitis virus (IBV) strains and to discriminate H120 vaccine strain from other strains. Viral RNA was extracted from the allantoic fluid of chicken embryos and from tissues of chickens experimentally infected with different strains of IBV. Amplification and identification of the viral RNA was performed using two sets of primers complementary to a region of the S glycoprotein gene in the Semi-N-RT-PCR assay. The pair of primers used in the first PCR consisted of universal oligonucleotides flanking a more variable region of S1-S2 gene. The second primer pair was used in the Semi-N-RT-PCR and was comprised of one of the primers from the first universal pair together with either another universal internal oligolucleotide or a oligonucleotide sequence specific for the H120 strain of IBV. The universal primers detected all reference IBV strains and field isolates tested herein. The Semi-N-RT-PCR had high sensitivity and specificity, and was able to differentiate the H120 vaccine strain from other reference IBV strains; including M41 strain. All tissue samples collected from chickens experimentally infected with H120 or M41 strains were positive in the semi-nested RT-PCR using universal primers, while only the H120-infected tissue samples were amplified by the set of primers containing the H120-oligonucleotide. In conclusion, the ability of Semi-N-RT-PCR to detect distinct IBV strains and preliminarily discriminate the vaccine strain (H120) closes a diagnostic gap and offers the opportunity to use comprehensive PCR procedures for the IBV diagnosis.

Identificação e caracterização de um isolado de Hydrangea ringspot virus em hortênsia no Estado de São Paulo

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Amplificação gênica alelo-específica na caracterização das hemoglobinas S, C e D e as interações entre elas e talassemias beta

INTRODUÇÃO: As hemoglobinopatias resultam de alterações hereditárias, sendo prevalentes em muitas regiões do mundo, mas atingem a população brasileira de forma significativa. Elas são decorrentes de alterações em genes estruturais responsáveis pelo aparecimento das hemoglobinas variantes e/ou em genes reguladores, resultando nas talassemias. A identificação dessas patologias tem sido rotineiramente realizada por procedimentos eletroforéticos, contudo nossa experiência laboratorial evidencia que as mesmas nem sempre apresentam resoluções suficientes para a correta caracterização da mutação. CASUÍSTICAS E MÉTODOS: O propósito deste trabalho foi estabelecer uma metodologia válida para a caracterização das hemoglobinas S, C e D em homozigose ou heterozigose, e suas possíveis interações, baseada na amplificação gênica alelo-específica (PCR-AE) com a utilização de primers sense, antisense e primers que se acoplam na posição do alelo mutante e na respectiva posição do alelo normal. RESULTADOS E DISCUSSÃO: Os resultados evidenciaram a validade dessa metodologia na caracterização das mutações, sendo esse procedimento de fácil realização, reprodutível e possível de ser aplicado em um significativo número de amostras.

Targeted Nucleotide Exchange in Bovine Myostatin Gene

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Comparação entre dois métodos de detecção de DNA de papilomavírus humano em carcinoma epidermoide de lábio

Introdução: Recentemente o papilomavírus humano (HPV) tem sido associado à carcinogênese oral. A metodologia empregada na detecção do vírus é uma das maiores causas observadas da grande variabilidade nas taxas de detecção do HPV. Objetivo: Este estudo comparou a sensibilidade de detecção do DNA do HPV em casos de carcinoma epidermoide de lábio utilizando a amplificação do DNA viral por reação em cadeia da polimerase (PCR) ou nPCR. Material e método: Foram utilizadas 33 amostras provenientes de casos de carcinoma epidermoide de lábio. Para as extrações do DNA utilizou-se o sistema QIAamp DNA Mini Kit. Como controle interno utilizou-se o gene da b-globina. Das 33 amostras iniciais, 30 foram positivas para o gene b-globina, sendo utilizadas para detectar o DNA viral. Comparou-se a amplificação do DNA viral pelos métodos da PCR com os oligonucleotídeos MY09/MY11 e nPCR, empregando-se os pares de oligonucleotídeos iniciadores MY09/MY11 e, na segunda etapa, o par GP5+/GP6+. O controle positivo para a presença do DNA do HPV utilizado foi a linhagem de células HeLa e, como controle negativo, a mistura de amplificação sem DNA. A análise dos produtos de PCR e nPCR para HPV foi realizada por eletroforese em gel de poliacrilamida a 8%. Resultados: Utilizando-se o método da PCR, a amplificação do DNA do HPV foi constatada em dois casos. Com a nPCR foi verificada presença de DNA viral em 13 das 30 amostras. Conclusão: Com a utilização da nPCR, a detecção do HPV nos casos estudados aumentou mais de seis vezes.

Human papillomavirus (HPV) detection in lip squamous cell carcinoma: correlation with clinical aspects and risk factors

O papilomavírus humano (HPV) está associado a um largo espectro de lesões em humanos e tem sido ligado à carcinogênese oral. O objetivo deste estudo foi investigar a presença do DNA do HPV em pacientes com carcinoma espinocelular de lábio e correlacioná-la com aspectos clínicos e fatores de risco. Foram estudados 33 pacientes com carcinoma espinocelular de lábio. Destes, 30 pacientes foram positivos para o gene da beta-globina humana e então foram testados para o DNA do HPV com uso da reação em cadeia de polimerase em duas etapas (PCR e nPCR) com os oligonucleotídeos iniciadores MY11/MY09 e GP5+/ GP6+. O DNA do HPV foi detectado em 43,33% dos 30 pacientes analisados. Não houve associação com os fatores de risco analisados.

Direct detection of infectious bursal disease virus from clinical samples by in situ reverse transcriptase-linked polymerase chain reaction

The presence of the very virulent (vv) Brazilian strain of infectious bursal disease virus (IBDV) was determined in the bursa of Fabricius, thymus and liver of 2-week-old broilers from a flock with a higher than expected mortality. For this purpose, a direct in situ reverse transcriptase (RT)-linked polymerase chain reaction (PCR) method was developed using specific primers for vvIBDV. Unlabelled forward and reverse biotinylated oligonucleotides were used for RT-PCR in a one-step method and the respective products were revealed by a direct enzymatic reaction. The results were compared with those obtained by standard RT-PCR using general primers for IBDV and virus isolation. The virus isolation, RT-PCR and in situ RT-PCR revealed positive results on the bursa of Fabricius in 86%, 80% and 100%, respectively. The in situ RT-PCR detected vvIBDV in all tested thymus and liver samples, whereas the standard RT-PCR detected virus in 80% and 90% of the samples, respectively. After three consecutive passages on chicken embryonated eggs, IBDV was isolated from 64% of the thymus samples and 30% of the liver samples. In the present study, no classical or antigenic variants of IBDV were detected. The developed in situ RT-PCR assay was able to detect the very virulent strain of IBDV with a higher sensitivity than the conventional RT-PCR and virus isolation.

Leishmania amazonensis: Partial purification and study of the biochemical properties of the telomerase reverse transcriptase activity from promastigote-stage

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Caracterização da região 3'-terminal do genoma de um isolado brasileiro do Southern bean mosaic virus

O presente trabalho caracteriza a região 3'-terminal do genoma de um isolado do Southern bean mosaic virus encontrado no Estado de São Paulo (SBMV-SP). O RNA foi extraído de partículas virais purificadas e submetido a RT-PCR usando oligonucleotídeos desenhados para amplificar 972 nt da região 3'-terminal do RNA viral. Foi obtido fragmento de tamanho esperado que inclui o gene da proteína capsidial e a região 3'-terminal não codificadora. O gene da proteína capsidial (ORF4) contém 801 nucleotídeos, incluindo-se o códon de terminação UGA, com seqüência deduzida de 266 aminoácidos e massa molecular estimada de 28.800 Da. Sessenta e um aminoácidos terminais da ORF2 estão sobrepostos na ORF4. O sinal de localização nuclear, encontrado dentro do Domínio R na região 5'-terminal da ORF4 de alguns sobemovírus, não foi identificado no SBMV-SP. Esse dado pode explicar a ausência de partículas virais do SBMV-SP no núcleo celular. A seqüência do SBMV-SP apresentou identidade de nucleotídeos e aminoácidos de, respectivamente, 91% e 93% com o isolado Arkansas (SBMV-ARK) descrito nos EUA. Os resultados obtidos indicam que o SBMV-SP e o SBMV-ARK são isolados muito proximamente relacionados.

Structural and functional characterization of neuwiedase, a nonhemorrhagic fibrin(ogen)olytic metalloprotease from Bothrops neuwiedi snake venom

A fibrino(geno)lytic nonhemorrhagic metalloprotease (neuwiedase) was purified from Bothrops neuwiedi snake venom by a single chromatographic step procedure on a CM-Sepharose column, Neuwiedase represented 4.5% (w/w) of the crude desiccated venom, with an approximate Mr of 20,000 and pI 5.9, As regards the amino acid composition, neuwiedase showed similarities with other metalloproteases, with high proportions of Asx, Glx, Leu, and Ser, Atomic absorption spectroscopy showed that one mole of Zn2+ and one mole of Ca2+ were present per mole olf protein. The cDNA encoding neuwiedase was isolated by RT-PCR from venom gland RNA, using oligonucleotides based on the partially determined amino-acid sequences of this metalloprotease. The fall sequence contained approximately 594 bp, which codified the 198 amino acid residues with an estimated molecular weight of 22,375. Comparison of the nucleotide and amino acid sequences of neuwiedase with those of other snake venom metalloproteases showed a high level of sequential similarity, Neuwiedase has two highly conserved characteristics sequences H(142)E(143)XXH(146)XXG(140)XXH(152) and C164I165M166. The three-dimensional structure of neuwiedase was modeled based on the crystal structure of Crotalus adamanteus Adamalysin II. This model revealed that the zinc binding site region showed a I high structural similarity with other metalloproteases,, the proteolyitc specificity, using the B beta-chain of oxidized insulin as substrate, was shown to be directed to the Ala(14)-Leu(15) and Tyr(16)-Leu(17) peptide bonds which were preferentially hydrolyzed. Neuwiedase is a A alpha,B beta fibrinogenase, Its activity upon the A alpha chain of fibrinogen was detected within 15 min of incubation. The optimal temperature and pH for the degradation of both A alpha and B beta chains were 37 degrees C and 7.4-8.0, respectively. This activity was inhibited by EDTA and 1,10-phenantroline, Neuwiedase also showed proteolytic activity upon fibrin and some components of the extracellular matrix. However, it did not show TAME esterase activity and was not able to inhibit platelet aggregation. (C) 2000 Academic Press.

Label-free DNA detection based on modified conducting polypyrrole films at microelectrodes

A label-free electrochemical detection method for DNA hybridization based on electrostatic modulation of the ion-exchange kinetics of a polypyrrole film deposited at microelectrodes is reported. Synthetic single-stranded 27-mer oligonucleotides (probe) have been immobilized at 2,5-bis(2-thienyl)-N-(3-phosphorylpropyl)pyrrole film formed by electropolymerization on the previously formed polypyrrole layer. The 27- or 18-mer target oligonucleotides were monitored via the electrochemically driven anion exchange of the inner polypyrrole film. The performance of the miniaturized DNA biosensor system was studied in respect to selectivity, sensitivity, reproducibility, and regeneration of the sensor. Control experiments were performed with a noncomplementary target of 27-mer DNA and 12 base-pair mismatched 18-mer sequences, respectively, and did not show any unspecific binding. Under optimized experimental conditions, the label-free electrochemical biosensor enabled the detection limits of 0.16 and 3.5 fmol for the 18- and 2 7-mer DNA strand, respectively. Furthermore, we demonstrate reusability of the electrochemical DNA biosensor after successful recovery of up to 100% of the original signal by regenerating the DNA label-free electrode with 50 mM HCl at room temperature.

Hypothalamic melanin-concentrating hormone is induced by cold exposure and participates in the control of energy expenditure in rats

Short-term cold exposure of homeothermic animals leads to higher thermogenesis and food consumption accompanied by weight loss. An analysis of cDNA-macroarray was employed to identify candidate mRNA species that encode proteins involved in thermogenic adaptation to cold. A cDNA-macroarray analysis, confirmed by RT-PCR, immunoblot, and RIA, revealed that the hypothalamic expression of melanin-concentrating hormone (MCH) is enhanced by exposure of rats to cold environment. The blockade of hypothalamic MCH expression by antisense MCH oligonucleotide in cold-exposed rats promoted no changes in feeding behavior and body temperature. However, MCH blockade led to a significant drop in body weight, which was accompanied by decreased liver glycogen, increased relative body fat, increased absolute and relative interscapular brown adipose tissue mass, increased uncoupling protein 1 expression in brown adipose tissue, and increased consumption of lean body mass. Thus, increased hypothalamic MCH expression in rats exposed to cold may participate in the process that allows for efficient use of energy for heat production during thermogenic adaptation to cold.