63 resultados para ANTISENSE RNA
em Repositório Institucional UNESP - Universidade Estadual Paulista "Julio de Mesquita Filho"
Resumo:
The occurrence, number of insertion sites and antisense RNA expression of micropia transposable element were studied in 26 species that belong to three subgroups (mercatorum, mulleri and hydei) of repleta group of Drosophila. Under high specific PCR, micropia sequences were detected in 11 species, but under less stringent condition, this retrotransposon was detected in all species. The widespread distribution of micropia suggests that this element was already present at the common ancestor of the repleta group of Drosophila. Southern blot analysis showed a variation from 0 to 17 different insertion sites and the occurrence of male-specific sequences. We found that the expression of the 1.0 kb micropia antisense RNA is variable among the species and tissues (soma and testis), which suggests that more than one mechanism regulates transposition in these species. Variation of amplification by PCR and of antisense RNA expression, as well as divergence of nucleotide sequences among the species allow us to suggest that at least two subfamilies of micropia transposable element are harbored by the genome of this species group.
Resumo:
To determine the incidence of rotavirus infection among dairy herds in the State of Sdo Paulo, Brazil, 576 faecal samples obtained from calves aged 1-45 days with and without diarrhoea, reared on 63 dairy cattle farms, were analyzed. Polyacrylamide gel electrophoresis (PAGE) identified 28 samples positive for group A rotavirus, while four samples, two diarrhoeic and two non-diarrhoeic, showed a bisegmented genome with a typical picobirnavirus pattern. Electron microscopy revealed spherical virus particles with a diameter of 37 nm and without a defined surface structure. The present study is the first report of a bisegmented virus identified in cattle in Brazil. (C) 2003 Elsevier B.V. Ltd. All rights reserved.
Resumo:
Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.
Resumo:
The human ZC3H14 gene encodes an evolutionarily conserved Cys(3)His zinc finger protein that binds specifically to polyadenosine RNA and is thus postulated to modulate post-transcriptional gene expression. Expressed sequence tag (EST) data predicts multiple splice variants of both human and mouse ZC3H14. Analysis of ZC3H14 expression in both human cell lines and mouse tissues confirms the presence of multiple alternatively spliced transcripts. Although all of these transcripts encode protein isoforms that contain the conserved C-terminal zinc finger domain, suggesting that they could all bind to polyadenosine RNA, they differ in other functionally important domains. Most of the alternative transcripts encode closely related proteins (termed isoforms 1, 2. 3, and 3short) that differ primarily in the inclusion of three small exons, 9, 10, and 11, resulting in predicted protein isoforms ranging from 82 to 64 kDa. Each of these closely related isoforms contains predicted classical nuclear localization signals (cNLS) within exons 7 and 11. Consistent with the presence of these putative nuclear targeting signals, these ZC3H14 isoforms are all localized to the nucleus. In contrast, an additional transcript encodes a smaller protein (34 kDa) with an alternative first exon (isoform, 4). Consistent with the absence of the predicted cNLS motifs located in exons 7 and 11, ZC3H14 isoform 4 is localized to the cytoplasm. Both EST data and experimental data suggest that this variant is enriched in testes and brain. Using an antibody that detects endogenous ZC3H14 isoforms 1-3 reveals localization of these isoforms to nuclear speckles. These speckles co-localize with the splicing factor, SC35, suggesting a role for nuclear ZC3H14 in mRNA processing. Taken together, these results demonstrate that multiple transcripts encoding several ZC3H14 isoforms exist in vivo. Both nuclear and cytoplasmic ZC3H14 isoforms could have distinct effects on gene expression mediated by the common Cys(3)His zinc finger polyadenosine RNA binding domain. (C) 2009 Elsevier B.V. All rights reserved.
Resumo:
mRNA stability is modulated by elements in the mRNA transcript and their cognate RNA binding proteins. Poly(U) binding protein 1 (Pub1) is a cytoplasmic Saccharomyces cerevisiae mRNA binding protein that stabilizes transcripts containing AU-rich elements (AREs) or stabilizer elements (STEs). In a yeast two-hybrid screen, we identified nuclear poly(A) binding protein 2 (Nab2) as being a Pub1-interacting protein. Nab2 is an essential nucleocytoplasmic shuttling mRNA binding protein that regulates poly(A) tail length and mRNA export. The interaction between Pub1 and Nab2 was confirmed by copurification and in vitro binding assays. The interaction is mediated by the Nab2 zinc finger domain. Analysis of the functional link between these proteins reveals that Nab2, like Pub1, can modulate the stability of specific mRNA transcripts. The half-life of the RPS16B transcript, an ARE-like sequence-containing Pub1 target, is decreased in both nab2-1 and nab2-67 mutants. In contrast, GCN4, an STE-containing Pub1 target, is not affected. Similar results were obtained for other ARE- and STE-containing Pub1 target transcripts. Further analysis reveals that the ARE-like sequence is necessary for Nab2-mediated transcript stabilization. These results suggest that Nab2 functions together with Pub1 to modulate mRNA stability and strengthen a model where nuclear events are coupled to the control of mRNA turnover in the cytoplasm.
Resumo:
Pre-mRNA maturation in trypanosomatids occurs through a process called trans-splicing which involves excision of introns and union of exons in two independent transcripts. For the first time, we present the standardization of Trypanosoma cruzi permeable cells (Y strain) as a model for trans-splicing study of mRNAs in trypanosomes, following by RNase protection reaction, which localizes the SL exon and intron. This trans-splicing reaction in vitro was also used to analyze the influence of NFOH-121, a nitrofurazone-derivative, on this mechanism. The results suggested that the prodrug affects the RNA processing in these parasites, but the trans-splicing reaction still occurred.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
The 5-year survival rate for oral cavity cancer is poorer than for breast, colon or prostate cancer, and has improved only slightly in the last three decades. Hence, new therapeutic strategies are urgently needed. Here we demonstrate by tissue micro array analysis for the first time that RNA-binding protein La is significantly overexpressed in oral squamous cell carcinoma (SCC). Within this study we therefore addressed the question whether siRNA-mediated depletion of the La protein may interfere with known tumor-promoting characteristics of head and neck SCC cells. Our studies demonstrate that the La protein promotes cell proliferation, migration and invasion of lymph node-metastasized hypopharyngeal SCC cells. We also reveal that La is required for the expression of beta-catenin as well as matrix metalloproteinase type 2 (MMP-2) within these cells. Taken together these data suggest a so far unknown function of the RNA-binding protein La in promoting tumor progression of head and neck SCC.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)
Resumo:
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)