PCR fluorescente associada à eletroforese capilar como ferramenta de diagnóstico de bactérias no semen

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.

Composition of Extracellular Polymeric Substances (EPS) produced by Flavobacterium columnare isolated from tropical fish in Brazil

Thirty nine isolates of Flavobacterium columnare from Brazilian fish farms had their carbohydrate composition of EPS evaluated by high efficiency liquid chromatography, using the phenol-sulfuric acid method of EPS. The occurrence of capsules on F. columnare cells was not directly related to biofilm formation, and the predominant monosaccharide is glucose.

Energy substrate used by workers of leaf-cutting ants during nest excavation

Energy substrate used by workers of leaf-cutting ants during nest excavation. In this study we aimed to ascertain whether leaf-cutting ant workers lose body reserves (fat or sugars) as a function of nest excavation. For each treatment, we isolated 10 workers of Atta sexdens into two experimental groups, Control (C- without excavation) and Soil (S- with excavation), which were kept for different time intervals (0, 24, 48 or 72 hours), totaling 700 tested workers. We then determined the concentration of soluble carbohydrates and total lipid content in them. The total carbohydrates were determined colorimetrically, based on the reaction between carbohydrates and sulfuric acid-phenol. For determination of lipids, the insects were immersed in organic solvent until they reached a constant weight. Our results showed that carbohydrates are consumed during nest excavation activities. In the experimental groups S24, S48 and S72, there was an average reduction of 5.82 (20.42%), 14.31 (44.96%) and 13.27 (43.96%) µ.mg-1 in soluble sugar when compared with the experimental groups that did not excavate. Furthermore, the lipids were not used during this activity. With respect to dry mass of the workers, their values were C0 = 8%, C24 = 10.4%, C48 = 9.2%, C72 = 10%, S24 = 9.2%, S48 = 8.7% and S72 = 8.5%. Our results show experimentally that the source of energy for nest excavation is carbohydrates, whereas lipids are conserved for other activities.

Produção de ligno-hemi-celulases por fermentação em estado sólido e avaliação dos efeitos da aplicação das enzimas na composição química e estrutura do bagaço e da palha de cana

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Avaliação do comportamento de superfícies de fratura por fractais mistos em materiais de diferentes classes

Pós-graduação em Engenharia Mecânica - FEG

Direct Synthesis of Ag Nanoparticles Incorporated on a Mesoporous Hybrid Material as a Sensitive Sensor for the Simultaneous Determination of Dihydroxybenzenes Isomers

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Using Proteomic Strategies for Sequencing and Post-Translational Modifications Assignment of Antigen-5, a Major Allergen from the Venom of the Social Wasp Polybia paulista

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

A Multivariate Calibration Procedure for UV/VIS Spectrometric Monitoring of BHK-21 Cell Metabolism and Growth

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Evaluation of caries-associated virulence of biofilms from Candida albicans isolated from saliva of pediatric patients with sickle-cell anemia

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Estudo da aplicabilidade do sistema pultrudado de fenólica/fibras de carbono em cabos condutores

Pós-graduação em Engenharia Mecânica - FEG

Estudo químico e atividade mutagênica e antirradicalar de caesalpinia ferrea

Pós-graduação em Química - IQ

Determination of carbofuran and diuron in FIA system using electrochemical sensor modified with organometallic complexes and graphene oxide

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Suitability of carbon fiber-reinforced polymers as power cable cores: Galvanic corrosion and thermal stability evaluation

The increasing demand for electrical energy and the difficulties involved in installing new transmission lines presents a global challenge. Transmission line cables need to conduct more current, which creates the problem of excessive cable sag and limits the distance between towers. Therefore, it is necessary to develop new cables that have low thermal expansion coefficients, low densities, and high resistance to mechanical stress and corrosion. Continuous fiber-reinforced polymers are now widely used in many industries, including electrical utilities, and provide properties that are superior to those of traditional ACSR (aluminum conductor steel reinforced) cables. Although composite core cables show good performance in terms of corrosion, the contact of carbon fibers with aluminum promotes galvanic corrosion, which compromises mechanical performance. In this work, three different fiber coatings were tested (phenol formaldehyde resin, epoxy-based resin, and epoxy resin with polyester braiding), with measurements of the galvanic current. The use of epoxy resin combined with polyester braiding provided the best inhibition of galvanic corrosion. Investigation of thermal stability revealed that use of phenol formaldehyde resin resulted in a higher glass transition temperature. On the other hand, a post-cure process applied to epoxy-based resin enabled it to achieve glass transition temperatures of up to 200 degrees C. (C) 2014 Elsevier Ltd. All rights reserved.

Caracterização física e mecânica de compensado produzido com dois diferentes adesivos em duas variações de pressão de prensagem

The adhesives used in the production of engineered boards have been object of study over the years in order to improve the properties of the boards with less energy consumption, lower production costs and reduced environmental impact. In addition to that, process variables may affect the properties of the board. The present study aimed to characterize sheets of plywood, manufactured with two types of adhesives, under two different pressing conditions. The adhesives used for the study were Phenol-formaldehyde and Polyurethane castor oil based. The pressure of pressing was varied in a range from 75 to 160 Bar, in order to verify how they influence the physical and mechanical properties of the board. The tests performed resulted in a conclusion that shows that the moister content of the veneers interferes on the physical and mechanical tests. In general, boards produced with polyurethane resin showed superior physical and mechanical results; although the ones produced with phenol formaldehyde at a pressure of 75 Bar had always equal or higher values, compared to what is found in literature

Produção e caracterização físico-mecânica de painel de compensado de Eucalyptus sp. e adesivo PVA

Studies on new adhesives and resins for bonding wood and wood products are being conducted with the intention of improving their properties, taking into account a lower environmental impact. For this reason new formulations of polyvinyl acetate (PVA) adhesives have been developed, because they have no chemicals in its composition extremely polluting and harmful to health, as is the case of formaldehyde-based resins, which in turn are the most commonly used today for wood panels production. This study tested three different formulations of PVA adhesives, with different times and temperatures of pressing for the production of Eucalyptus sp. Plywood, coming up in satisfactory results with respect to shear strength at the bondline, which was higher for the PVA adhesives compared with urea-formaldehyde and phenol. The results of MOE and MOR were lower than those values of the panels produced with urea and phenol-formaldehyde, and the results of physical tests showed to be close to the panels produced with these same adhesives