Influência do herpesvirus bovino tipo 5 no semen congelado de bovino sobre os parâmetros espermáticos e desenvolvimento embrionário in vitro

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

PCR fluorescente associada à eletroforese capilar como ferramenta de diagnóstico de bactérias no semen

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.

Semen parameters and seminal plasma protein and biochemical profiles of dogs with benign prostatic hyperplasia after botulinum toxin type A intraprostatic injection

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Prostatic acid phosphatase in serum and semen of dogs

The incidence of prostatic malignancy has increased the use of tissue markers to detect cancer. Tissue specific antigens or differentiation antigens are found on the surface of normal cells. Clinically, these antigens are important to diagnose alterations in the tissues and for immunotherapy. The objective of the present study was to evaluate the prostatic acid phosphatase concentration in blood and seminal plasma of intact and healthy dogs at different ages. The evaluation was carried out by spectrophotometer, using a commercial kit. The prostatic acid phosphatase (PAP) levels did not differ according to the age and did not correlate with age or prostatic dimensions verified by ultrasonography. The PAP concentration values varied greatly within each group. However, more studies are necessary to evaluate the role of prostatic acid phosphatase in the canine prostate and its importance as a diagnostic test for prostate disorders.

Semen characteristics of captive common marmoset (Callithrix jacchus): a comparison of a German with a Brazilian colony

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Sperm fertility and viability following 48 h of refrigeration: Evaluation of different extenders for the preservation of bull semen in liquid state

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)