Evidence of sexual transmission of Toxoplasma gondii in goats

Male goats of reproductive age that were serologically negative for Toxoplasma gondii were selected and distributed according to the following arrangement: (A) one goat infected orally with 2.0 × 105 oocysts; (B) one goat infected subcutaneously with 1.0 × 106 tachyzoites; and (C) one uninfected goat kept as a control. After T. gondii inoculation, 12 non-pregnant female breeder goats that were serologically negative for the main reproductive diseases, especially toxoplasmosis, were synchronized and then exposed to natural mating by the males that had previously been inoculated: five females exposed to natural mating by male A (group GI); five females exposed to natural mating by male B (group GII); and two females exposed to natural mating by the uninfected male C (group GIII). In serum samples obtained from all the female goats before and after natural mating, the presence of antibodies against T. gondii was investigated using the ELISA test. PCR was performed on semen samples, on females and fetal tissues and placenta. Ten out of the 12 females showed specific antibodies against T. gondii after natural mating: five in GI and five in GII. On several dates on which natural mating occurred, T. gondii was identified in semen samples from the infected males, using PCR. Subsequently, after the females had been sacrificed, it was also possible to identify T. gondii in tissue samples from the infected females and from their fetuses, stillbirths and offspring, using PCR. Therefore, these results prove, for the first time, that T. gondii infection can be transmitted sexually from male to female goats. © 2013 Elsevier B.V. All rights reserved.

Identification of polymorphisms in the osteopontin gene and their associations with certain semen production traits of water buffaloes in the Brazilian Amazon

Contents: The osteopontin gene may influence the fertility of water buffaloes because it is a protein present in sperm. The aim of this work was to identify polymorphisms in this gene and associate them with fertility parameters of animals kept under extensive grazing. A total of 306 male buffaloes older than 18 months, from two farms, one in the state of Amapá and the other in the state of Pará, Brazil were used in the study. Seven SNPs were identified in the regions studied. The polymorphisms were in gene positions 1478, 1513 and 1611 in the region 5′upstrem and positions 6690, 6737, 6925 and 6952 in the region amplified in intron 5. The SNPs were associated with the traits, namely scrotal circumference, scrotal volume, sperm motility, sperm concentration and sperm pathology. There were significant SNPs (p < 0.05) for all the traits. The SNP 6690 was significant for scrotal circumference, sperm concentration, sperm motility and sperm pathology and the SNP 6737 for scrotal volume. The genotype AA of SNP 6690 presented the highest averages for scrotal circumference, sperm concentration and motility and the lowest total number of sperm pathologies. For the scrotal volume trait, the animals with the largest volume were correlated with the presence of the genotype GG of SNP 6737. These results indicate a significance of the osteopontin gene as it seems to exert a substantial influence on the semen production traits of male buffaloes. © 2013 Blackwell Verlag GmbH.

Influência do herpesvirus bovino tipo 5 no semen congelado de bovino sobre os parâmetros espermáticos e desenvolvimento embrionário in vitro

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Transmissão sexual do Toxoplasma gondii (Nicolle & Manceaux, 1909) em caprinos (Capra hircus)

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Influência do fotoperíodo artificial na produção de oócitos e competência no desenvolvimento embrionário em cabras (Capra hircus-Linnaeus-1758) estimuladas com FSH-ov no anestro estacional

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

PCR fluorescente associada à eletroforese capilar como ferramenta de diagnóstico de bactérias no semen

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.

Semen parameters and seminal plasma protein and biochemical profiles of dogs with benign prostatic hyperplasia after botulinum toxin type A intraprostatic injection

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Prostatic acid phosphatase in serum and semen of dogs

The incidence of prostatic malignancy has increased the use of tissue markers to detect cancer. Tissue specific antigens or differentiation antigens are found on the surface of normal cells. Clinically, these antigens are important to diagnose alterations in the tissues and for immunotherapy. The objective of the present study was to evaluate the prostatic acid phosphatase concentration in blood and seminal plasma of intact and healthy dogs at different ages. The evaluation was carried out by spectrophotometer, using a commercial kit. The prostatic acid phosphatase (PAP) levels did not differ according to the age and did not correlate with age or prostatic dimensions verified by ultrasonography. The PAP concentration values varied greatly within each group. However, more studies are necessary to evaluate the role of prostatic acid phosphatase in the canine prostate and its importance as a diagnostic test for prostate disorders.

Semen characteristics of captive common marmoset (Callithrix jacchus): a comparison of a German with a Brazilian colony

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)