Avaliação da imunidade celular sob a ação de imunomoduladores en neonatos caninos até 45 dias de idade

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Avaliação de testes sorológicos no diagnóstico da brucelose suína em amostras provenientes de um frigorífico e de um rebanho naturalmente infectado do Estado de São Paulo

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Fatores de risco e comparação de técnicas de diagnóstico para campilobacterose genital bovina em touros do município de Presidente Prudente - SP

Pós-graduação em Medicina Veterinária - FMVZ

Avanços na criopreservação do sêmen ovino I: diluidores e crioprotetores

The effectiveness of using frozen sheep semen in artificial insemination programs requires the development of extenders and freezing protocols that will increase pregnancy rate of inseminated females. This work aimed to survey the main extenders, additives and external and internal cryoprotectants that have been employed to improve the maintenance levels of sperm parameters after the freezing-thawing process. Better rates of post-thawing sheep sperm viability may be obtained with changes in the freezing extender composition, whether by the adjustment of its components or by introducing additives that inhibit the occurrence of sperm changes during the cryopreservation process. Thus, the possible changes proposed must take into consideration the intrinsic characteristics of ram semen and the individual variability among animals. It is important to emphasize that the sperm cryopreservation effectiveness requires that all process steps are conducted in an integrated manner, to maximize the fertility rate of frozen ram semen.

PCR fluorescente associada à eletroforese capilar como ferramenta de diagnóstico de bactérias no semen

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.

Caracterização da suinocultura em Mossoró, Rio Grande do Norte: aspectos sanitários e riscos de zoonoses

Pós-graduação em Medicina Veterinária - FCAV

Sero-epidemiological survey for brucellosis, leptospirosis, and toxoplasmosis in free-ranging Alouatta caraya and Callithrix penicillata from Sao Paulo State, Brazil

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Evaluation of ERIC-PCR as Genotyping Method for Corynebacterium pseudotuberculosis Isolates

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Serological survey and risk factors for brucellosis in water buffaloes in the state of Para, Brazil

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Fauna helmintológica de ovinos provenientes da microrregião de Jaboticabal, estado de São Paulo, Brasil

This study evaluated the prevalence and counting parasitism of different species of helminths of sheep from the micro-region of Jaboticabal of Sao Paulo state. For this, 66 animals naturally infected, four to 36 months of age, raised in pasture, were selected. The results of necropsy revealed the presence of seven genera and 12 species with the following prevalence and mean count: Haemonchus contortus: 100.0% (2947.2); Trichostrongylus colubriformis: 90.9% (3048.8); Cooperia curticei: 56.0% (256.5); Oesophagostomum columbianum: 48.4% (36.0); Cooperia punctata: 30.3% (94.5); Trichostrongylus axei: 22.7% (26.5); Strongyloides papillosus: 19.6% (83.0), Haemonchus contortus (L4): 7.5% (17.2), Cooperia pectinata: 10.6% (12.9), Trichuris ovis: 10.6 % (0.6); Cooperia spatulata 4.5% (0.3); Capillaria bovis: 4.5% (0.1). The mean parasitism of helminthswas 6524.7 per animal. Haemonchus contortus (adults and L4) and Trichostrongylus colubriformis corresponded to 45.4% and 46.7% of the average worm burden totally, respectively. Based in the results obtained in this study, can be concluded that the two most abundant species of helminths and important, the micro-region of Jaboticabal are Trichostrongylus colubriformis and Haemonchus contortus, and these two species amounted to 92.1% of the distribution percentage of helminths collected from all animals. These results demonstrate the importance of conducting a counts of eggs per gram of feces (EPG) in the herds of this region when FAMACHA is used on a particular property, since this method control does not allow to diagnostic the damage/clinical signs in animals infected by T. colubriformis, because this specie does not have hematophagism habit on animals.

Prevalência e fatores de risco para brucelose suína em Mossoró-RN

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Serology for brucellosis in free-ranging crab-eating foxes (Cerdocyon thous) and brown-nosed coatis (Nasua nasua) from Brazilian Pantanal

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Proposição de uma nova vacina para Brucelose bovina usando uma abordagem biotecnológica

A utilização de novas tecnologias empregando a biologia molecular busca superar os principais problemas encontrados nas vacinas atualmente comercializadas no combate à brucelose bovina. Desta forma, a identificação de proteínas imunogênicas e a posterior transformação dos genes correspondentes em micro-organismos competentes tem sido um dos principais alvos para o desenvolvimento de novas formas de controle da infecção. O presente trabalho tem como objetivo propor, em base teórica, uma vacina de eficácia e segurança superiores às encontradas atualmente no mercado contra a brucelose bovina, antropozoonose contagiosa provocada principalmente pela espécie Brucella abortus. Essa enfermidade produz infecção característica em bovinos e bubalinos e é infecciosa ao homem, causando doença crônica que leva à incapacidade parcial ou total para o trabalho. Por ter distribuição universal, acarreta problemas sanitário e de saúde pública importantes e grandes prejuízos econômicos. A vacina proposta visa o desenvolvimento de microorganismos transformados contendo genes de proteínas de potencial imunológico que, após purificação, são usadas para o combate da doença. As proteínas recombinantes abordadas no presente estudo são as proteína ribossomal L7/L12 e a lumazina sintetase que, ao serem utilizadas em uma vacina subcelular, diferente das comercializadas atualmente, induzem resposta de longa duração, não induzem a produção de anticorpos que interfiram no diagnóstico e não são patogênicas ao homem.

Padronização do teste dot blotting e comparação entre testes de diagnóstico de brucelose em bovinos

Pós-graduação em Medicina Veterinária - FCAV

Transtornos reprodutivos causados por agentes infecciosos em animais de canis comerciais da microrregião de Ribeirão Preto, estado de São Paulo

Pós-graduação em Medicina Veterinária - FCAV