Serum DHEA-S increases in dogs naturally infected with Ehrlichia canis

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Humoral immune responses against the malaria vaccine candidate antigen Plasmodium vivax AMA-1 and IL-4 gene polymorphisms in individuals living in an endemic area of the Brazilian Amazon

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Molecular and serological detection of Babesia Bovis and Babesia Bigemina in cattle in the Rio de Janeiro, Brazil

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

First molecular characterization of Cryptosporidium spp. infecting buffalo calves in Brazil

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

First genetic identification of Cryptosporidium parvum subtype IIaA14G2R1in beef cattle in Brazil

The presence of Cryptosporidium spp. in a cattle herd registered with an outbreak of diarrhea was investigated and the the molecular subtyping of Cryptosporidium parvum was characterized. Fecal samples from 85 Nellore beef cattle (Bos indicus) were collected and examined with Ziehl-Neelsen modified staining method. Fifty-four cattle (63.52%) had Cryptosporidium spp. oocysts in their feces. Fragments of genes encoding the 18S ribosomal RNA subunit and a 60-kDa glycoprotein (gp60) were amplified by nested PCR accomplished in the 11 most heavily parasitized samples, and the amplicons were sequenced. Eight of the 11 analyzed samples were positive for 18S rRNA sequences and identified monospecific infections with C. parvum. Seven samples were positive for gp60 and identified subtypes IIaA15G2R1 (6/11) and IIaA14G2R1 (1/11). This report is the first for C. parvum subtype IIaA14G2R1 in beef cattle in Brazil.

Validação diagnóstica para a detecção de Cryptosporidium spp. em bovinos

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Detecção molecular de Ehrlichia canis em cães e em órgãos de seus respectivos carrapatos

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Infectious bronchitis virus: detection and vaccine Strain differentiation by semi-nested RT-PCR

A semi-nested reverse transcription-polymerase chain reaction (Semi-N-RT-PCR) was developed and used to detect the S glycoprotein gene of infectious bronchitis virus (IBV) strains and to discriminate H120 vaccine strain from other strains. Viral RNA was extracted from the allantoic fluid of chicken embryos and from tissues of chickens experimentally infected with different strains of IBV. Amplification and identification of the viral RNA was performed using two sets of primers complementary to a region of the S glycoprotein gene in the Semi-N-RT-PCR assay. The pair of primers used in the first PCR consisted of universal oligonucleotides flanking a more variable region of S1-S2 gene. The second primer pair was used in the Semi-N-RT-PCR and was comprised of one of the primers from the first universal pair together with either another universal internal oligolucleotide or a oligonucleotide sequence specific for the H120 strain of IBV. The universal primers detected all reference IBV strains and field isolates tested herein. The Semi-N-RT-PCR had high sensitivity and specificity, and was able to differentiate the H120 vaccine strain from other reference IBV strains; including M41 strain. All tissue samples collected from chickens experimentally infected with H120 or M41 strains were positive in the semi-nested RT-PCR using universal primers, while only the H120-infected tissue samples were amplified by the set of primers containing the H120-oligonucleotide. In conclusion, the ability of Semi-N-RT-PCR to detect distinct IBV strains and preliminarily discriminate the vaccine strain (H120) closes a diagnostic gap and offers the opportunity to use comprehensive PCR procedures for the IBV diagnosis.

Further characterization of two sequiviruses infecting lettuce and development of specific RT-PCR primers

Lettuce mottle virus (LeMoV) and dandelion yellow mosaic virus (DaYMV) infect lettuce in South America and Europe, respectively. LeMoV and DaYMV possess isometric particles, occur at low concentrations in plants and have narrow host ranges. Partial genome sequences of both viruses were obtained using purified viral preparations and universal primers for members of the family Sequiviridae. DaYMV and LeMoV sequences were analyzed and showed identity with other members of the family. Universal primers that detect both viruses and specific primers for LeMoV and DaYMV were designed and used in RT-PCR-based diagnostic assays. These results provide the first molecular data on the LeMoV and DaYMV genomes and suggest that LeMoV is a member of the genus Sequivirus, probably distinct from DaYMV.

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Bidens mosaic virus: detecção via RT-PCR e identificação de Galinsoga parviflora como um novo hospedeiro natural do vírus

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Assessment of cytokine values in serum by RT-PCR in HIV-1 infected individuals with and without highly active anti-retroviral therapy (HAART)

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Quantitative real-time RT-PCR and chromogenic in situ hybridization: precise methods to detect HER-2 status in breast carcinoma

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

The heminested RT-PCR for the study of rabies virus pathogenesis

The aim of the present trial was to evaluate the heminested RT-PCR for the study of rabies virus distribution in mice inoculated experimentally. Inoculation was by the intramuscular route in 150 mice, using the dog street rabies virus. Groups of five animals were killed at different times. Fragments of different organs were collected and the material was tested by Fluorescent Antibody Test (FAT) and heminested RT-PCR (hn RT-PCR). Positive results were obtained beginning on the 10th day after inoculation in the brain, spinal cord, salivary gland, limbs, lungs, liver, spleen, urinary bladder, tongue and right kidney. Hn RT-PCR was shown to be more efficient for the study of rabies virus distribution in different tissues and organs. (C) 2004 Elsevier B.V.. All rights reserved.

Comparison between RT-PCR and the mouse inoculation test for detection of rabies virus in samples kept for long periods under different conditions

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)