Enxertia no controle da murcha bacteriana na atividade de enzimas e produção em tomateiro

Pós-graduação em Agronomia (Horticultura) - FCA

Participação do receptor toll-like4 na resposta imune durante a esporotricose ecperimental

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Digestão ruminal da matéria seca, da proteína bruta e do amido de grãos de milho e de sorgo (com e sem tanino) submetidos a processamento

Pós-graduação em Zootecnia - FMVZ

Degradação de poluentes orgânicos utilizando filmes de TiO2 modificados com íons prata

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Avaliação de métodos para tratamento de resíduos químicos originados em laboratórios biológicos

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Detecção molecular de Streptococus agalactiae em amostras de leite bovino obtidas de tanques de expansão

Pós-graduação em Medicina Veterinária - FMVZ

PCR fluorescente associada à eletroforese capilar como ferramenta de diagnóstico de bactérias no semen

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.

Composition of Extracellular Polymeric Substances (EPS) produced by Flavobacterium columnare isolated from tropical fish in Brazil

Thirty nine isolates of Flavobacterium columnare from Brazilian fish farms had their carbohydrate composition of EPS evaluated by high efficiency liquid chromatography, using the phenol-sulfuric acid method of EPS. The occurrence of capsules on F. columnare cells was not directly related to biofilm formation, and the predominant monosaccharide is glucose.

Energy substrate used by workers of leaf-cutting ants during nest excavation

Energy substrate used by workers of leaf-cutting ants during nest excavation. In this study we aimed to ascertain whether leaf-cutting ant workers lose body reserves (fat or sugars) as a function of nest excavation. For each treatment, we isolated 10 workers of Atta sexdens into two experimental groups, Control (C- without excavation) and Soil (S- with excavation), which were kept for different time intervals (0, 24, 48 or 72 hours), totaling 700 tested workers. We then determined the concentration of soluble carbohydrates and total lipid content in them. The total carbohydrates were determined colorimetrically, based on the reaction between carbohydrates and sulfuric acid-phenol. For determination of lipids, the insects were immersed in organic solvent until they reached a constant weight. Our results showed that carbohydrates are consumed during nest excavation activities. In the experimental groups S24, S48 and S72, there was an average reduction of 5.82 (20.42%), 14.31 (44.96%) and 13.27 (43.96%) µ.mg-1 in soluble sugar when compared with the experimental groups that did not excavate. Furthermore, the lipids were not used during this activity. With respect to dry mass of the workers, their values were C0 = 8%, C24 = 10.4%, C48 = 9.2%, C72 = 10%, S24 = 9.2%, S48 = 8.7% and S72 = 8.5%. Our results show experimentally that the source of energy for nest excavation is carbohydrates, whereas lipids are conserved for other activities.

Produção de ligno-hemi-celulases por fermentação em estado sólido e avaliação dos efeitos da aplicação das enzimas na composição química e estrutura do bagaço e da palha de cana

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Avaliação do comportamento de superfícies de fratura por fractais mistos em materiais de diferentes classes

Pós-graduação em Engenharia Mecânica - FEG

Direct Synthesis of Ag Nanoparticles Incorporated on a Mesoporous Hybrid Material as a Sensitive Sensor for the Simultaneous Determination of Dihydroxybenzenes Isomers

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

A Multivariate Calibration Procedure for UV/VIS Spectrometric Monitoring of BHK-21 Cell Metabolism and Growth

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Evaluation of caries-associated virulence of biofilms from Candida albicans isolated from saliva of pediatric patients with sickle-cell anemia

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Estudo da aplicabilidade do sistema pultrudado de fenólica/fibras de carbono em cabos condutores

Pós-graduação em Engenharia Mecânica - FEG