156 resultados para ANALYZER
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Pós-graduação em Ciências da Motricidade - IBRC
Resumo:
This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.
Resumo:
The present study aimed to evaluate the droplet spectrum of hydraulic nozzles, under different pressures and spray liquid compositions, using a laser particle size analyzer. In a completely randomized design, two air induction twin flat-fan nozzles (AD-IA/D 11002 and AD-IA/D11004) and two hollow-cone nozzles (MAG - 2 and MAG - 4) were evaluated, in factorial design 3 x 2: tree spray pressures (207, 276 and 345 kPa for twin flat-fan nozzles, and 414, 483 and 552 kPa for cone nozzles); and two spray liquid compositions (water and water plus phosphatydilcoline + propionic acid adjuvant). The addition of adjuvant reduced the volume median diameter for the AD-IA/D 11002 and 11004 nozzles; however it had an opposite effect with the MAG - 4 nozzles and not changed with the MAG - 2 nozzles. In adverse weather conditions, it is not recommended the use of hollow cone spray nozzle, even with the addition of adjuvant tested because of the high risk potential of drift.
Resumo:
Pós-graduação em Agronomia (Energia na Agricultura) - FCA
Resumo:
Pós-graduação em Engenharia Mecânica - FEG
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
The present work aimed to evaluate the volumetric distribution profiles, droplet spectra, surface tension, contact angle of droplet and the spraying liquid deposition over the peanut leaves (Arachis hypogaea L.), under artificial rain, in comparison with deposition without rain, using two hydraulic nozzle models of plain fan and insecticide spraying liquids with and without adjuvants addition. It were used a patternator for volumetric distribution analysis, a laser particles analyzer to evaluate droplet spectra produced by SF 110015 and XR 110015 nozzles and tensiometer for droplet tension and contact angle. The spraying liquids evaluated were: water, lambda-cialotrina, lambda-cialotrina + nitrogen fertilizer and lambda-cialotrina + mineral oil. All experiments followed a completely randomized design. Data were submitted to variance analysis by F test and the means comparisons by Scott-Knott test at 5% of probability. According to the results, it must be considered the maximum spacing in spray boom usage of 50 and 90 cm between the nozzles SF110015 and XR110015, respectively. The adjuvants effects on droplet spectra have shown addicted to the nozzle and the product used, and the adjuvants addition to the spraying liquid affected the potential risk of drift; The Volumetric Median Diameter (VMD) of produced droplets by nozzles filled into thin class and were not influenced by the adjuvants. The nitrogen fertilizer adjuvant may be indicated to promote improvements on coverage and droplet deposition on target.
Resumo:
The performance and emissions behavior of a Rover 1S/60 turboshaft engine when operated with several blends of aviation kerosene and ox tallow ethyl-ester are shown in this article. The tests were performed with a compressor shaft coupled to an hydraulic dynamometer where data of power and mass fuel flow were collected to determine the brake specific fuel consumption. A flue gas analyzer was positioned at the exhaust duct to collect oxygen, carbon dioxide, carbon monoxide and nitrous oxides. An increase in the specific fuel consumption was observed due to the lesser lower heating value of the most oxygenated blends. However, reductions of CO, CO2 and NO (x) have been observed and no-significant ill effects have occurred in the turbine operation.
Resumo:
Pós-graduação em Agronomia (Produção Vegetal) - FCAV
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)
Resumo:
The objective of this study was to evaluate the structure of Tanzania grassland grazed by goats managed with different residue leaf area index (RLAI) under intermittent stocking. The experiment was carried out from February to August, 2008. The treatments consisted of three different targets RLAI (0.8, 1.6 and 2.4) and 95% light interception (LI) criterion determined the rest period. Forage samples were collected at average height sampling points and weighed. Subsequently, a smaller sample was removed to separate the morphological components (leaf, stem and dead material) and to determine the structural and productive features. The canopy architecture was evaluated by the method of inclined point quadrat. The pre-grazing height in the paddocks were significantly different among treatments. RLAI influenced dry matter contents of green forage, leaf, stem and total, with the exception of dry matter of dead material, where the lowest values were observed for 0.8 RLAI. Thus, RLAI modifies canopy structure and is sensitive to canopy height changes throughout the year. Pasture regrowth is not compromised by residual leaf area indexes between 0.8 and 2.4, when climatic factors are not limiting.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
The aim of this experiment was to study the influence of transparent, blue and red tree shelters on gas exchanges of canafístula’s (Peltophorum dubium (Spreng.) Taub.) seedlings. This study was carried out in Department of Botany, Institute of Biosciences, U ESP, Botucatu, São Paulo State, Brazil. The experiment design was randomized blocks, with 5 replications, each one containing 6 units of each treatment (nonsheltered, transparent tree shelters, blue tree shelters and red tree shelters). The evaluations of gas exchanges were made through an infrared gas analyzer. It follows that the tree shelters use may limit the photosynthesis, increase the transpiration and stomatal opening, besides reducing the water use efficiency. The colored tree shelters use created unfavorable conditions for the development, reducing the photosynthesis, because they reflected the blue and red wavelengths, allowing only the passage of the other components of the white light or of the photosynthetically active radiation