Mapeamento RH comparativo do cromossomo X de búfalo de rio (Bubalus bubalis) / Patrícia Ianella

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

A terra (des)construída na mídia impressa do Pontal do Paranapanema

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

O percurso da indianidade na literatura brasileira: matizes da figuração

Pós-graduação em Letras - IBILCE

Profilaxia antirrábica humana: proposta de uma nova metodologia de ação

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Suplementação de ácidos graxos poli-insaturados protegidos no desempenho e respostas imunológicas de bovinos nelores confinados

Pós-graduação em Zootecnia - FMVZ

Sobressemeadura de forrageiras de clima temperado em pastagens tropicais

Pós-graduação em Zootecnia - FMVZ

Estudo fitoquímico e biológico de Aristolochia ridicula

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

A tragédia na ficção de Mário de Andrade

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Propriedades físico-hídricas, compactação do solo, desenvolvimento radicular e produtividade da soja em diferentes manejos de solo

A cultura da soja (Glycine Max L.) faz parte da rotação de culturas praticadas pelos irrigantes do sudoeste paulista, os quais praticam o plantio direto como forma de uso sustentável do solo. O objetivo do trabalho foi avaliar o efeito dessa prática conservacionista sobre as propriedades físico-hídricas do solo, sobre sua compactação, sobre o desenvolvimento radicular e sobre a produtividade da cultura da soja, comparativamente com o preparo convencional. O experimento foi conduzido na Fazenda Buriti-Mirim, município de Angatuba, SP (23º30'13" S, 48º35'37" W; 640m), durante o segundo semestre de 2003, utilizando uma área de Argissolo Acinzentado irrigada por pivô central, dividida em dois tipos de manejo do solo preparo convencional e plantio direto. Embora no plantio direto tenha-se encontrado maior densidade do solo, menor quantidade de água disponível e menor resistência do solo à penetração, os dois manejos não diferiram quanto ao desenvolvimento radicular e a produtividade da soja.

Segurança nacional, soberania e sociedade civil

Este artigo pretende sustentar que, no atual quadro histórico mundial, o problema da segurança nacional e da soberania não pode ser analisado com os mesmos conceitos de antes: não é mais uma questão do Estado em sentido estrito, nem muito menos um problema militar, ainda que continue a ser uma questão de Estado. O problema deixou de pertencer exclusivamente ao campo das relações entre Estados e tornou-se um problema das comunidades como um todo, povos, governos, empresas, sociedades civis, cidadãos. Ultrapassou as fronteiras nacionais, por mais que continue a se enraizar em experiências nacionais concretas e a encontrar nelas boa parte de suas determinações. Justamente por isto, não pode ser resolvido nem “fora” do Estado ou “sem” o Estado, nem exclusivamente pelo Estado.

Between the processes of strengthening and weakening of the Family Health Strategy

This was a qualitative study with the purpose of designing a meta-model for the work process of the Family Health Strategy (FHS) team. It was based on the experience of six sample groups, composed of their members (physicians, professional nurses, dentists, dental assistants, licensed technical nurses and community health agents) in a city in São Paulo state, Brazil, totaling 54 subjects. Six theoretical models emerged from non-directive interviews. These were analyzed according to Grounded Theory and submitted to the meta-synthesis strategy, which produced the meta-model between the processes of strengthening and weakening of the FHS model: professional-team-community reciprocity as an intervening component. When analyzed in light of the Theory of Complexity (TC), it showed to be a work with a vertical and authoritarian tendency, which is largely hegemonic in the tradition of public health care policies.

PCR fluorescente associada à eletroforese capilar como ferramenta de diagnóstico de bactérias no semen

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.

Study of K beta X-ray emission spectroscopy applied to Mn((2-x))V((1+x))O4 (x=0 and 1/3) oxyspinel and comparison with XANES

Oxidation state and coordination of transition metal cations seems to be hard to assess when considering multiple cations, each one with different possible oxidation states. In fact, this is the case of the spineltype double oxides family. High resolution K beta X-ray fluorescence spectra were measured in Mn(2-x)V(1+4)O4 (x=0 and 1/3) spinels-type double oxides in order to determine the oxidation state and coordination of V and Mn cations. The relative intensity of radiative Auger effect KM2,3M4,5 to the total intensity and the integral absolute difference value were used as reference parameters for the characterization of Mn oxidation states. The coordination of Mn ions was inferred by the intensity of the K beta(5) line. In the case of V compounds, it was used as the intensity of the line K beta' relative to the total area of K beta region. The obtained results were further compared with X-ray absorption spectra analysis, showing good agreements regarding the oxidation state characterization. However, there were found some discrepancies in coordination, due to customary oversimplifications in the K beta(5) line origin. The obtained results might represent valuable and useful data for chemical scopes of characterizing spineltype oxides family. (C) 2013 Elsevier Ltd. All rights reserved.

Análise técnica e econômica das etapas de produção de mudas de eucalipto

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Post-partum anoestrus in tropical beef cattle: A systems approach combining gene expression and genome-wide association results

The length of the post-partum anoestrous interval affects reproductive efficiency in many tropical beef cattle herds. In this study, results from genome-wide association studies (Experiment 1: GWAS) and gene expression (Experiment 2: microarray) were combined in a systems approach to reveal genetic markers, genes and pathways underlying the physiology of post-partum anoestrus in tropically adapted cattle. The microarray study measured the expression of 13,964 genes in the hypothalamus of Brahman cows. A total of 366 genes were differentially expressed (DE) in the post-partum period, when acyclic cows were compared to cows that had resumed ovarian cycles. Associated markers (P < 0.05) from a high density GWAS pointed to 2829 genes that were associated with post-partum anoestrous interval (PPAI) in two populations of beef cattle: Brahman and Tropical composite. Together the experiments provided evidence for 63 genes that are likely to influence the resumption of ovulation post-partum in tropically adapted beef cattle. Functional annotation analysis revealed that some of the 63 genes have known roles in hormonal activity, energy balance and neuronal synapse plasticity. Polymorphisms within candidate genes identified by this systems approach could have biological significance in post-partum anoestrus and help select Zebu (Bos indicus) influenced cattle with genetic potential for shorter post-partum anoestrus. Crown Copyright (C) 2014 Published by Elsevier B.V. All rights reserved.