493 resultados para semen
Resumo:
Semen cryopreservation is still considered suboptimal due to lower fertility when compared to fresh semen. The reasons for the loss of fertility are various and related to irreversible damage caused to the cells during the freeze-thaw process. An alternative to conventional cryopreservation represents the use of chilled bull semen, preventing the damage associated with freezing, thereby guaranteeing greater sperm viability. The aim of this study was to describe the use of cooled bull semen as a strategy to increase the pregnancy for Fixed-Time Artificial Insemination (FTAI) of Nellore (Bos indicus) cows. One ejaculate of a select Nellore bull obtained by electroejaculation was used; the semen sample was fractioned into two aliquots: one diluted in Botu-Bov® extender containing 6.4% glycerol for cryopreservation (BB-F, frozen group) and one diluted in the same extender, free from cryoprotectants and used for cooling (BB-C, cooled semen group). The samples in the BB-C group were chilled to 5°C using an isothermic box and maintained for 24 h prior to use. A total of 349 lactating Nellore cows (70-90 days after birth) were synchronized by the insertion of a progesterone releasing device (1.0 g) and estradiol benzoate (2.0 mg i.m.) on a random day of the estrous cycle (Day 0); FTAI was performed 44-48 h after the removal of the device. The pregnancy rates were 45.71 and 61.49% (P<0.05), respectively, for the cryopreserved or chilled bovine semen groups. In conclusion, the use of bull semen cooled for 24 h represents an alternative to conventionally cryopreserved semen, as determined by the increase the pregnancy per artificial insemination in bovine herds. © 2012 Science Publication.
Resumo:
Cooling of equine semen obtained from some stallions results in lower seminal quality and viability when the seminal plasma (SP) is present. The objective of this study was to evaluate the effect of the removal of SP using a Sperm Filter on the viability of cooled stallion semen. For this purpose, 31 stallions were used. Their ejaculates were divided into three groups: CN, semen was diluted with an extender; FLT, SP was removed by filtration; and CT, SP was removed by centrifugation and cooled to 15°C for 24 hours. Sperm kinetics and plasma membrane integrity were evaluated immediately after collection (T0) and after 24 hours of refrigeration (T1). No difference (P > .05) was noted at T1 for total sperm motility (TM), progressive sperm motility, or plasma membrane integrity when semen samples from all the stallions were analyzed. However, when samples from stallions termed bad coolers were analyzed (TM = <30% at T1), a difference was observed in TM and progressive sperm motility for CN compared with FLT and CT at T1. Sperm recovery was greater when SP was removed using the filter (FLT) to that when the SP was removed by centrifugation (CN) (89% vs. 81%). Thus, we concluded that filtering with a Sperm Filter is an efficient and practical method for removal of SP from stallion ejaculates, with lower sperm loss than centrifugation. We also found that the presence of SP reduces the quality and viability of cooled semen from stallions whose semen is sensitive to the process of refrigeration. © 2013 Elsevier Inc.
Resumo:
Evaluation of the damage caused by the sperm preservation process is crucial to improving fertilization rates. The objective of this study was to evaluate the effects of refrigeration temperature (5°C and 15°C) and storage time (0, 12, 24, 48, and 72 hours) on apoptotic markers in equine semen. Membrane phosphatidylserine translocation index, caspase activation index, and DNA fragmentation index were analyzed using epifluorescence microscopy. Analysis of variance was used for statistical analysis, and Tukey test was used to compare means. The significance level was set at P < .05. The results demonstrated that for transport duration shorter than 24 hours, semen quality was maintained when stored at either 5°C or 15°C. A storage temperature of 5°C should be used when it is necessary to transport semen for longer than 24 hours. There was a significant decrease in semen quality after 48 hours of refrigeration. © 2013 Elsevier Inc.
Resumo:
In the present study, different freezing systems (Styrofoam box and Mini Digitcool ZH 400) and storage volumes (0.5- and 0.25-mL straws) were compared with regard to sperm kinetics and plasma membrane integrity of frozen and thawed semen. For that, three ejaculates from four animals were frozen in Styrofoam box and Mini Digitcool ZH 400 machine. The 0.5-mL straws were thawed at 46°C for 20 seconds, and the 0.25-mL straws were thawed at 46°C for 12 seconds. Statistical analysis was performed using program R of descriptive analysis box plot, followed by analysis of variance using PROC MIXED of SAS 9.1 package. Variances of 5% were considered as different. There was no interaction between the straw sizes and volumes; however, statistical differences were observed between the semen storage volumes. The 0.5-mL straws had higher total motility (%), progressive motility (%), average path velocity (μm/s), straight-line velocity (μm/s), curvilinear velocity (μm/s), and rapid sperm percentage (%) than the 0.25-mL straws. However, plasma membrane integrity analysis did not differ between the two straws. Thus, it is possible to conclude that equine sperm cryopreserved in 0.5-mL straws has better sperm kinetics than when stored in 0.25-mL straws. Additionally, it is possible to conclude that automated systems that enable faster freezing rates result in a seminal quality that is similar to the one obtained by the conventional system using Styrofoam boxes. © 2013 Elsevier Inc.
Resumo:
Seminal plasma removal, an indispensable step in equine semen cryopreservation, is usually done by centrifugation, but this might cause mechanical damage to sperm. A new method for seminal plasma removal from stallion semen, namely a filter composed of a synthetic hydrophilic membrane (Sperm Filter, BotuPharma, Botucatu, Sao Paulo, Brazil), was recently proposed. The objective of this study was to test the use of the Sperm Filter in the removal of seminal plasma before freezing stallion semen. Ejaculates from 31 stallions were divided into two groups and cryopreserved. In group 1 (G1), seminal plasma was removed with the Sperm Filter, and in group 2 (G2), seminal plasma was removed by centrifugation (600× g for 10 minutes). There were no differences (P < 0.05) between G1 and G2 in sperm kinetic parameters or plasma membrane integrity before or after cryopreservation. However, sperm recovery rate was higher (P < 0.05) for G1 versus G2 (mean ± SD, 89.4 ± 7.4% vs. 80.9 ± 5.5%). Therefore, the Sperm Filter was as efficient as centrifugation in removing seminal plasma from the stallion ejaculate. However, filtering was more practical and had significantly fewer sperm lost than the centrifugation technique. © 2013 Elsevier Inc.
Resumo:
In recent years the concept of genomic resource banks has grown as a way of maintaining the genetic variability of populations, while the quality of cryopreservation of the gametes determines the effectiveness of such banks. However, the absence of basic knowledge regarding the physiology of species and their semen characteristics hampers the establishment of reproductive biotechnologies. Thus, this paper aimed to determine certain physicochemical (volume, colour, appearance, pH and osmolarity) and microscopic characteristics (mass movement, motility, vigour, concentration, and sperm morphology and morphometry) of semen of the species Mazama americana. To achieve this, five males of the species were used, and three semen samples per buck (electroejaculation) were collected at intervals of 2 weeks. The volume, pH and osmolarity of the ejaculate were 0.39 ± 0.14 mL, 6.90 ± 0.74 and 297.74 ± 19.10 mOsm/kg, respectively, while the values obtained for mass movement, motility, vigour and concentration were 3.33 ± 0.82; 69.6 ± 8.92%; 3.53 ± 0.50, and 244.07 ± 98.65 × 107/mL, respectively. Regarding the colour of the ejaculate, five samples were classified as ivory, two as yellowish, two as whitish and six as white. Regarding appearance, seven samples were considered creamy and eight, milky. Morphology was analysed in a humid chamber under phase contrast microscopy and 73.50 ± 5.57% of cells presented normal morphology, 8.37 ± 3.15% presented major defects and 18.13 ± 6.46% presented minor defects. To determine sperm morphometry, an optical microscope (Leica DM 5000B) and the Leica Qwin image analyser program were used, resulting in 8.09 ± 0.40, 4.65 ± 0.30, 2.81 ± 0.44 and 30.25 ± 3.02 m for length, largest width, smallest width and area, respectively. Copyright © CSIRO 2013.
Resumo:
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)
Resumo:
The present study was undertaken the protein composition in 2D-electrophoretic pattern (2DE) of the seminal plasma (SP) can interfere in the semen bull freezability, and if we can use that for predicting semen bull freezability. Samples were obtained of 20 bulls (different breeds) with a minimum of 3 years history semen production in commercial semen collection Center. All animals ranged between 2 - 7 years of age. The semen freezability was calculated by # of thawed and approved ejaculates / # of ejaculates submitted to cryopreservation (after semen evaluation and approved to submitted to freeze). The bulls were divided in 3 groups: HIGH (=>80% ejaculates approved); MEDIUM (>60% and <79% ejaculates approved); LOW (=<59% ejaculates approved); the pattern and criteria were the same used in the routine of the commercial semen Center. 68 gels were carried through by 2DE of SP samples indicated 225 detected spots with protein different amount (VION) comparing. Comparing bull ́s semen freezability and VION of each spot found difference among 2 spots from High and Low, even considering just spots with % of detection frequency bigger than 75%. The taurine bulls demonstrated more homogeneous profile when comparing with zebu bulls, considering number and frequency of appearance of spots. The results showed that proteomics can be a useful tool to predict the semen freezability, but we ́ll need to study better the interactions between sperm membrane, seminal plasma and extender to comprehend better which proteome phenotype interfere positive or negatively in the semen freezability.
Resumo:
Contents: The osteopontin gene may influence the fertility of water buffaloes because it is a protein present in sperm. The aim of this work was to identify polymorphisms in this gene and associate them with fertility parameters of animals kept under extensive grazing. A total of 306 male buffaloes older than 18 months, from two farms, one in the state of Amapá and the other in the state of Pará, Brazil were used in the study. Seven SNPs were identified in the regions studied. The polymorphisms were in gene positions 1478, 1513 and 1611 in the region 5′upstrem and positions 6690, 6737, 6925 and 6952 in the region amplified in intron 5. The SNPs were associated with the traits, namely scrotal circumference, scrotal volume, sperm motility, sperm concentration and sperm pathology. There were significant SNPs (p < 0.05) for all the traits. The SNP 6690 was significant for scrotal circumference, sperm concentration, sperm motility and sperm pathology and the SNP 6737 for scrotal volume. The genotype AA of SNP 6690 presented the highest averages for scrotal circumference, sperm concentration and motility and the lowest total number of sperm pathologies. For the scrotal volume trait, the animals with the largest volume were correlated with the presence of the genotype GG of SNP 6737. These results indicate a significance of the osteopontin gene as it seems to exert a substantial influence on the semen production traits of male buffaloes. © 2013 Blackwell Verlag GmbH.
Resumo:
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)
Resumo:
This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
The incidence of prostatic malignancy has increased the use of tissue markers to detect cancer. Tissue specific antigens or differentiation antigens are found on the surface of normal cells. Clinically, these antigens are important to diagnose alterations in the tissues and for immunotherapy. The objective of the present study was to evaluate the prostatic acid phosphatase concentration in blood and seminal plasma of intact and healthy dogs at different ages. The evaluation was carried out by spectrophotometer, using a commercial kit. The prostatic acid phosphatase (PAP) levels did not differ according to the age and did not correlate with age or prostatic dimensions verified by ultrasonography. The PAP concentration values varied greatly within each group. However, more studies are necessary to evaluate the role of prostatic acid phosphatase in the canine prostate and its importance as a diagnostic test for prostate disorders.
Resumo:
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)