204 resultados para Factor de necrosis tumoral alfa (TNF-alfa)
Resumo:
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
The purpose of this study was to review the literature regarding the action of the cytokines interleukin 10 (IL-10) and tumor necrosis factor-alpha (TNF-α) in pregnancy and to emphasize the factors that are of interest to clinical obstetrics. The literature highlights several actions of IL-10 and TNF-α during pregnancy. The actions of these cytokines seem to be antagonistic and dependent on the balance between them, which is orchestrated by the specific immunosuppressive action of IL-10. TNF-α has a characteristic inflammatory action, and it is an additional diabetogenic factor in pregnancy. The loss of the control of the production of these cytokines, with increase of TNF-α, is related to the risk for developing obstetric complications, particularly recurrent fetal loss, gestational diabetes mellitus, hypertensive syndromes, and fetal growth restriction. However, study results are controversial and are not clearly defined. These issues are attributed to the heterogeneity of the studies, particularly regarding their sample sizes and sources, the evaluation methods, and the multiplicity of factors and conditions that influence cytokine production. These questions are fundamental and should be addressed in future investigations to obtain more consistent results that can be applied to obstetric practice.
Resumo:
No presente trabalho, foram utilizadas 21 fêmeas suínas, virgens, sexualmente aptas, criadas e mantidas sob condições industriais, para observação dos perfis hormonais séricos de 17-alfa-OH progesterona e androstenediona, durante o ciclo estral. As colheitas de sangue foram efetuadas sempre no mesmo intervalo, entre 8 e 10 horas. Cada animal foi submetido a 14 punções venosas, distribuídas nos dias zero, 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 21, 22 e 23 do ciclo estral. Considerou-se o dia zero como o primeiro dia da fase estral, e o 23º dia como o primeiro do estro subseqüente. Os ensaios para dosagens hormonais foram executados utilizando-se a técnica de radioimunoensaio (RIE) em fase sólida e para isso foi empregado conjunto de reagentes comerciais (Coat-A-Count®). Para o hormônio 17-alfa-OH progesterona, foram encontrados valores médios que variaram entre 0,18 e 2,7 ng/ml e para o hormônio androstenediona esses valores oscilaram entre 0,08 e 0,24 ng/ml.
Resumo:
Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
In this study, the effect of Yersinia derivatives on nitric oxide (NO), hydrogen peroxide (H2O2) and tumor necrosis factor-alpha (TNF-alpha) production by murine peritoneal macrophages was investigated. Addition of lipopolysaccharide (LPS) to the macrophage culture resulted in NO production that was dose dependent. on the other hand, bacterial cellular extract (CE) and Yersinia outer proteins (Yops) had no effect on NO production. The possible inhibitory effect of Yops on macrophage cultures stimulated with LPS was investigated. Yops partially inhibited NO production (67.4%) when compared with aminoguanidine. The effects of Yersinia derivatives on H2O2 production by macrophages were similar to those on NO production. LPS was the only derivative that stimulated H2O2 release in a dose-dependent manner. All Yersinia derivatives provoked the production of TNF-alpha, but LPS had the strongest effect, as observed for NO production. CE and Yops stimulated TNF-alpha production to a lesser extent than LPS. The results indicate the possibility that in vivo Yops may aid the evasion of the bacteria from the host defense mechanism by impairing the secretion of NO by macrophages. (C) 2003 Elsevier SAS. All rights reserved.
Resumo:
OBJETIVO: Investigar a influência do inibidor não-seletivo da ciclooxigenase, cetoprofeno (ceto) intravenoso, em alterações histológicas e dos níveis das citocinas renais - fator α de necrose tumoral (TNF- α) e interleucina 1 (IL-1) - após hemorragia de 30% da volemia (10%, três vezes, em intervalos de 10 min). MÉTODOS: Sob anestesia com sevoflurano (sevo), os grupos sevo e sevo+ceto (10 ratos cada) foram preparados cirurgicamente para leitura de pressão arterial média (PAM) e administração de solução de Ringer (5 mL/kg/h) e de cetoprofeno (1,5 mg/kg), no início da anestesia, no grupo sevo+ceto. Mediu-se temperatura retal continuamente. Os valores de temperatura e PAM foram observados antes da primeira hemorragia (T1), após a terceira hemorragia (T2) e 30 min após T2 (T3). Realizada nefrectomia bilateral nos dois grupos para análise histológica e imuno-histoquímica. RESULTADOS: Nos dois grupos, temperatura e PAM diminuíram com relação aos valores basais. Hipotermia foi mais acentuada no grupo sevo (p=0,0002). Necrose tubular foi mais frequente no grupo sevo (p=0,02). As citocinas estiveram igualmente presentes nos rins dos dois grupos. CONCLUSÃO: Cetoprofeno foi mais protetor no rim de rato durante anestesia com sevoflurano e hipovolemia, porém parece que TNF- α e IL-1 não estão envolvidas nessa proteção.
Resumo:
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
We investigated the production of interleukin-6 (IL-6) and tumor necrosis factor-alpha (TNF-alpha) during canine visceral leishmaniasis (VL) to gain a better understanding of the role of such multi-functional cytokines in parasite resistance. IL-6 and TNF-alpha levels were measured by capture ELISA in sera from 8 healthy dogs from a non-endemic area (control group) and in sera from 16 dogs from Aracatuba, SP, Brazil, an area endemic for leishmaniosis. The dogs from the endemic area were selected by positive ELISA serology against total Leishmania chagasi antigen, positive spleen imprints for Leishmania, and the presence of at least three clinical signs associated with active visceral leishmaniasis (fever, dermatitis, lymphoadenopathy, onychogryphosis, weight loss, cachexia, locomotory difficulty, conjunctivitis, epistaxis, hepatosplenomegaly, edema, and apathy).Enhanced systemic IL-6 production was found in sera from dogs with the active disease compared to healthy dogs (t-test, P < 0.05). In contrast, TNF-alpha did not differ between the two groups studied. There was no correlation between IL-6 production and anti-leishmanial antibody titers in the sera. Our findings suggest that IL-6 is a good marker of active disease during leishmaniasis, and that other cytokines may be involved in the hypergammaglobulinemia characteristic of canine visceral leishmaniasis. (c) 2006 Published by Elsevier B.V.
Resumo:
Dogs are the main domestic reservoirs of L. (L.) chagasi. Once in the vertebrate host, the parasite can cause visceral leishmaniasis, which can also be transmitted to humans. Cytokines are key elements of the host immune response against Leishmania spp. To investigate whether tumor necrosis factor (TNF)-alpha, interleukin (IL)-4 and IL-10 are associated with pattern infection in dogs, these cytokines were quantified in the spleen and liver of dogs naturally infected with L. (L.) chagasi, with or without clinical manifestations, and their levels were correlated with the parasite load verified in these organs. A total of 40 adult dogs naturally infected with L. (L.) chagasi were assessed, together with 12 uninfected control dogs. Samples from spleen and liver were used to determine the cytokine levels by capture ELISA and for quantifying parasite load by real-time PCR. Statistical analysis was performed using the minimum Chi square method and group means were compared using the Tukey test. TNF-alpha, IL-4 and IL-10 levels in infected dogs were higher than in control groups; the liver was the main cytokine-producing organ during infection. The level of splenic TNF-alpha showed correlation with parasite load and may represent an important marker for infection process evolution, with the participation of IL-10. These results may contribute to a clearer understanding of the immune response in dogs infected with L. (L.) chagasi, which may lead to the development of prophylactic or preventive measures for these animals.
Resumo:
Coupled bone turnover is directed by the expression of receptor-activated NF-kappa B ligand (RANKL) and its decoy receptor, osteoprotegerin (OPG). Proinflammatory cytokines, such as interleukin-1 beta (IL-1 beta) and tumor necrosis factor-alpha (TNF-alpha) induce RANKL expression in bone marrow stromal cells. Here, we report that IL-1 beta and TNF-alpha-induced RANKL requires p38 mitogen-activating protein kinase (MAPK) pathway activation for maximal expression. Real-time PCR was used to assess the p38 contribution toward IL-1 beta and TNF-alpha-induced RANKL mRNA expression. Steady-state RANKL RNA levels were increased approximately 17-fold by IL-1 beta treatment and subsequently reduced similar to 70%-90% when p38 MAPK was inhibited with SB203580. RANKL mRNA stability data indicated that p38 MAPK did not alter the rate of mRNA decay in IL-1 beta-induced cells. Using a RANKL-luciferase cell line receptor containing a 120-kB segment of the 5' flanking region of the RANKL gene, reporter expression was stimulated 4-5-fold by IL-1 beta or TNF-alpha treatment. IL-1 beta-induced RANKL reporter expression was completely blocked with specific p38 inhibitors as well as dominant negative mutant constructs of MAPK kinase-3 and -6. In addition, blocking p38 signaling in bone marrow stromal cells partially inhibited IL-1 beta and TNF-alpha-induced osteoclastogenesis in vitro. Results from these studies indicate that p38 MAPK is a major signaling pathway involved in IL-1 beta and TNF-alpha-induced RANKL expression in bone marrow stromal cells.
Resumo:
Human monocytes activated by recombinant tumor necrosis factor alpha (TNF-alpha) exhibited significant fungicidal activity on the yeast cells of a highly virulent strain of Paracoccidioides brasiliensis. This process was significantly inhibited in the presence of catalase (CAT - a scavenger of H2O2), but not in the presence of superoxide-dismutase (SOD - a scavenger of superoxide anion) or N-G-monomethyl-L- arginine (N-G-MMLA - a nitric oxide inhibitor). Furthermore, there was a direct association between the intracellular killing of the fungus and the production of H2O2 by activated cells. These results strongly suggest a role for H2O2 in the killing of highly virulent strains of P. brasiliensis by TNF-alpha-activated human monocytes.