PCR fluorescente associada à eletroforese capilar como ferramenta de diagnóstico de bactérias no semen

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.

Estudo de aspectos químicos, biológicos e biossintéticos em Piper fuligineum Kunth(Piperaceae)

Pós-graduação em Química - IQ

Reduced graphene oxide multilayers for gas and liquid phases chemical sensing

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Characterization of natural rubber membranes using scaling laws analysis

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Transporte placentário via cavéola na placenta de bovinos clonados e transgênicos

Pós-graduação em Ciência e Tecnologia Animal - FEIS

Microalgas na Produção de Biodiesel: Extração e Composição Lipídica

The uninterrupted rise in emission of greenhouse gases open way to the use of biofuels, due to politics that focus on fuel safe, clean and renewable. The use of microalgae for biodiesel production has been described as one of the most promising sources of biomass for biofuels. The aim of this study was to evaluate the extraction and lipid profile of the microalgae Dunaliella tertiolecta, Isochrysis galbana and Tetraselsim gracilis. The extractions were performed with solvents chloroform /methanol and petroleum ether. The lipid profile was analyzed by gas chromatography after transesterification.The petroleum ether showed more efficiency in the extraction, the best result obtained was in the microalgae D. tertiolecta with 19.52% of lipid. The lipid profile analysis indicated a biodiesel stable to oxidation and elevated viscosity

Micropartículas de metotrexato e ácido poli lático-co-glicólico obtidas por “spray-drying”

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Incorporação da apatita na superfície da liga Ti30ta empregando tratamento alcalino associado à eletrofiação de fibras de PCL

Pós-graduação em Engenharia Mecânica - FEG

Compósitos de nanocelulose / PHBV: manta microfibrilica por eletrofiação

Pós-graduação em Engenharia Mecânica - FEG

Esteroide e Triterpenos de espécies de Qualea: Bioatividade sobre Mycobacterium tuberculosis

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Esteroide e Triterpenos de espécies de Qualea: bioatividade sobre Mycobacterium tuberculosis

The chloroform extract of bark of the tropical tree Qualea parviflora (Vochysiaceae) was fractionated by column chromatography on silica gel, yielding triterpenes (lupeol, lupenone, betulin, epi-betulinic acid and friedelin) and a steroid (β-sitosterol). β-sitosterol, lupenone and lupeol were also identified in Q. grandiflora and Q. multiflora, while friedelin was detected only in Q. Multiflora, by means of gas chromatography-mass spectrometry. The anti-Mycobacterium tuberculosis activity of the chloroform extract and isolated compounds was assayed by MABA and MIC values ranged from 250.0 to 31.2 µg/mL. This study is the first to investigate the chemistry and antitubercular activity of apolar compounds from Qualea species.

Insecticidal Effect of Extracts from Native Plants of Mato Grosso do Sul State on Sitophilus zeamais Mots (Coleoptera: Curculionidae)

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Constituintes Químicos de Hyptidendron canum R. Harley (Lamiaceae)

CHEMICAL CONSTITUENTS OF Hyptidendron canum (Pohl ex Benth.) R. Harley (LAMIACEAE). Chemical investigation of Hyptidendron canum stems resulted in the isolation of betulinic, ursolic and euscaphic acids. From the leaves were isolated 3β-O- β-galactopiranosilsitosterol, ursolic aldehyde, and mixtures of maslinic acid and 2α-hydroxyursolic acid, α and β-amyrin, uvaol and erythrodiol, sitosterol and stigmasterol, spathulenol and globulol. Hexane and chloroform leave fractions as well as ursolic and betulinic acids showed antifungal activities against the yeast form of Paracoccidioides brasiliensis.

Antitumor Activity of Kielmeyera Coriacea Leaf Constituents in Experimental Melanoma, Tested in Vitro and in Vivo in Syngeneic Mice

Purpose: The antitumor activity of Kielmeyera coriacea (Clusiaceae), a medicinal plant used in the treatment of parasitic, as well as fungal and bacterial infections by the Brazilian Cerrado population, was investigated. Methods: A chloroform extract (CE) of K. coriacea was tested in the murine melanoma cell line (B16F10-Nex2) and a panel of human tumor cell lines. Tumor cell migration was determined by the wound-healing assay and the in vivo antitumor activity of CE was investigated in a melanoma cell metastatic model. 1H NMR and GC/MS were used to determine CE chemical composition. Results: We found that CE exhibited strong cytotoxic activity against murine melanoma cells and a panel of human tumor cell lines in vitro. CE also inhibited growth of B16F10- Nex2 cells at sub lethal concentrations, inducing cell cycle arrest at S phase, and inhibition of tumor cell migration. Most importantly, administration of CE significantly reduced the number of melanoma metastatic nodules in vivo. Chemical analysis of CE indicated the presence of the long chain fatty compounds, 1-eicosanol, 1-docosanol, and 2-nonadecanone as main constituents. Conclusion: These results indicate that K. coriacea is a promising medicinal plant in cancer therapy exhibiting antitumor activity both in vitro and in vivo against different tumor cell lines.

Aplicação do método Phitoscreening para determinação de hidrocarbonetos clorados no município de Porto Feliz - SP

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)