563 resultados para bactérias fecais
Resumo:
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)
Resumo:
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)
Resumo:
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)
Resumo:
Pós-graduação em Microbiologia Agropecuária - FCAV
Resumo:
Pós-graduação em Ciências Biológicas (Microbiologia Aplicada) - IBRC
Resumo:
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)
Resumo:
Pós-graduação em Agronomia (Proteção de Plantas) - FCA
Resumo:
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)
Resumo:
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Chlamydophila psittaci is a bacterium that causes respiratory or systemic disease in birds and humans. Owing to the risk of transmission from asymptomatic birds to humans, the objective of this study was to detect the presence of Chlamydophila spp. in asymptomatic birds. Four hundred and three fecal samples or cloacal swabs were collected from domestic, wild or exotic birds. The 403 samples were examined by real time PCR specific for the 16S subunit of rRNA gene using SsoFastEvaGreen®SupermixTM (Bio-Rad) and melting curve analysis. Hemi-nested PCR specific for the OMP-A gene, accomplished in real-time PCR positive samples, was followed by sequencing of the amplified fragments to determine the genotype of C. psittaci. Real-time PCR was positive in 17 (4.21%) samples. Hemi-nested PCR revealed positivity in two samples previously positive by real-time PCR. Sequencing of the fragment amplified by hemi-nested PCR allowed for the identification of genotype A of C. psittaci in one sample. The results of this experiment show that the real-time PCR targeting the 16S rRNA gene followed by melting curve analysis can be used for diagnosis of Chlamydophila sp. in fecal samples of asymptomatic birds. The classification of the Chlamydophila species and the genotype of C. psittaci must be accomplished by PCR targeting the ompA gene and sequencing of the amplified fragments.
Resumo:
This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.
Resumo:
The persistence of MCs in aquatic environments and their difficult removal in the conventional water treatment is a challenge to companies of sanitation. However, the MCs are susceptible to degradation by bacteria present in water, sediment and sewage effluents. In this study, we investigated the biodegradation of MCs by microorganism present in carbon filters with biological activity (BAC) and their phylogenetic identification by sequencing gene 16S RNA. A study of water containing MCs was used, with different compositions, plus a filters BAC effluent. The results showed that of MCs were biodegraded by microorganism present in the biofilm. This study provides the ability to complete biodegradation of MCs by bacteria present in BAC filters and the possible use of these microorganisms as alternative of the removal of MCs in the treatment of drinking water
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Pós-graduação em Agronomia (Produção Vegetal) - FCAV