Comparação entre as técnicas de RT-PCR e inoculação intracerebral em camundongos para detecção do vírus da raiva em amostras mantidas por longos períodos em diferentes estados de conservação

Pós-graduação em Ciência Animal - FMVA

Desenvolvimento da técnica de RT-PCR-ELISA para a detecção do vírus da bronquite infecciosa das aves (VBI)

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Avaliação da microbiota presente na mucosa intestinal de frangos de corte alimentados com ração à base de milho ou sorgo através de PCR em tempo real

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Presence of infectious agents and co-infections in diarrheic dogs determined with a real-time polymerase chain reaction-based panel

Background: Infectious diarrhea can be caused by bacteria, viruses, or protozoan organisms, or a combination of these. The identification of co-infections in dogs is important to determine the prognosis and to plan strategies for their treatment and prophylaxis. Although many pathogens have been individually detected with real-time polymerase chain reaction (PCR), a comprehensive panel of agents that cause diarrhea in privately owned dogs has not yet been established. The objective of this study was to use a real-time PCR diarrhea panel to survey the frequencies of pathogens and co-infections in owned dogs attended in a veterinary hospital with and without diarrhea, as well the frequency in different countries. Feces samples were tested for canine distemper virus, canine coronavirus, canine parvovirus type 2 (CPV-2), Clostridium perfringens alpha toxin (CPA), Cryptosporidium spp., Giardia spp., and Salmonella spp. using molecular techniques.Results: In total, 104 diarrheic and 43 control dogs that were presented consecutively at a major private veterinary hospital were included in the study. Overall, 71/104 (68.3%) dogs with diarrhea were positive for at least one pathogen: a single infection in 39/71 dogs (54.9%) and co-infections in 32/71 dogs (45.1%), including 21/32 dogs (65.6%) with dual, 5/32 (15.6%) with triple, and 6/32 (18.8%) with quadruple infections. In the control group, 13/43 (30.2%) dogs were positive, all with single infections only. The most prevalent pathogens in the diarrheic dogs were CPA (40/104 dogs, 38.5%), CPV-2 (36/104 dogs, 34.6%), and Giardia spp. (14/104 dogs, 13.5%). CPV-2 was the most prevalent pathogen in the dual co-infections, associated with CPA, Cryptosporidium spp., or Giardia spp. No statistical difference (P = 0.8374) was observed in the duration of diarrhea or the number of deaths (P = 0.5722) in the presence or absence of single or co-infections.Conclusions: Diarrheic dogs showed a higher prevalence of pathogen infections than the controls. Whereas the healthy dogs had only single infections, about half the diarrheic dogs had co-infections. Therefore, multiple pathogens should be investigated in dogs presenting with diarrhea. The effects of multiple pathogens on the disease outcomes remain unclear because the rate of death and the duration of diarrhea did not seem to be affected by these factors.

Assessment of a quantitative 5' nuclease real-time polymerase chain reaction using the nicotinamide adenine dinucleotide dehydrogenase gamma subunit (nuoG) for Bartonella species in domiciled and stray cats in Brazil

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Real time B-mode ultrasound in pacas pregnancy (Agouti paca, Linnaeus, 1766)

O objetivo deste estudo foi estabelecer o tempo de prenhez da paca por meio de ultra-sonografia. Nove pacas prenhes foram periodicamente acompanhadas com um transdutor eletrônico setorial bi-frequencial de 5,0 e 7,5 MHz, em modo B, desde a detecção ultra-sonográfica da vesícula embrionária ou do feto até o nascimento dos filhotes. Os animais foram colocados em uma gaiola de ferro de prensagem lateral e permaneceram em posição quadrupedal durante as sessões. Um pano escuro foi usado para cobrir a gaiola e frutas foram oferecidas durante o exame ultra-sonográfico para evitar reações agressivas. Quanto mais precocemente ocorreu a detecção de prenhez, maior foi o período de acompanhamento ultra-sonográfico até o nascimento dos filhotes. Apenas um filhote nasceu por parto, com 796,5 ± 74,36 gramas (valor médio ± desvio padrão da amostra) e 33,46 ± 0,60 centímetros (valor médio ± desvio padrão da amostra) de comprimento (entre a borda rostral do focinho e a extremidade distal da cauda). O período de prenhez da paca abrange 135 a 139 dias.

Infectious bronchitis virus: detection and vaccine Strain differentiation by semi-nested RT-PCR

A semi-nested reverse transcription-polymerase chain reaction (Semi-N-RT-PCR) was developed and used to detect the S glycoprotein gene of infectious bronchitis virus (IBV) strains and to discriminate H120 vaccine strain from other strains. Viral RNA was extracted from the allantoic fluid of chicken embryos and from tissues of chickens experimentally infected with different strains of IBV. Amplification and identification of the viral RNA was performed using two sets of primers complementary to a region of the S glycoprotein gene in the Semi-N-RT-PCR assay. The pair of primers used in the first PCR consisted of universal oligonucleotides flanking a more variable region of S1-S2 gene. The second primer pair was used in the Semi-N-RT-PCR and was comprised of one of the primers from the first universal pair together with either another universal internal oligolucleotide or a oligonucleotide sequence specific for the H120 strain of IBV. The universal primers detected all reference IBV strains and field isolates tested herein. The Semi-N-RT-PCR had high sensitivity and specificity, and was able to differentiate the H120 vaccine strain from other reference IBV strains; including M41 strain. All tissue samples collected from chickens experimentally infected with H120 or M41 strains were positive in the semi-nested RT-PCR using universal primers, while only the H120-infected tissue samples were amplified by the set of primers containing the H120-oligonucleotide. In conclusion, the ability of Semi-N-RT-PCR to detect distinct IBV strains and preliminarily discriminate the vaccine strain (H120) closes a diagnostic gap and offers the opportunity to use comprehensive PCR procedures for the IBV diagnosis.

Genetic associations between carcass traits measured by real-time ultrasound and scrotal circumference and growth traits in Nelore cattle

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Further characterization of two sequiviruses infecting lettuce and development of specific RT-PCR primers

Lettuce mottle virus (LeMoV) and dandelion yellow mosaic virus (DaYMV) infect lettuce in South America and Europe, respectively. LeMoV and DaYMV possess isometric particles, occur at low concentrations in plants and have narrow host ranges. Partial genome sequences of both viruses were obtained using purified viral preparations and universal primers for members of the family Sequiviridae. DaYMV and LeMoV sequences were analyzed and showed identity with other members of the family. Universal primers that detect both viruses and specific primers for LeMoV and DaYMV were designed and used in RT-PCR-based diagnostic assays. These results provide the first molecular data on the LeMoV and DaYMV genomes and suggest that LeMoV is a member of the genus Sequivirus, probably distinct from DaYMV.

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Bidens mosaic virus: detecção via RT-PCR e identificação de Galinsoga parviflora como um novo hospedeiro natural do vírus

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Neural network based estimation of torque in induction motors for real-time applications

Induction motors are largely used in several industry sectors. The selection of an induction motor has still been inaccurate because in most of the cases the load behavior in its shaft is completely unknown. The proposal of this article is to use artificial neural networks for torque estimation with the purpose of best selecting the induction motors rather than conventional methods, which use classical identification techniques and mechanical load modeling. Since proposed approach estimates the torque behavior from the transient to the steady state, one of its main contributions is the potential to also be implemented in control schemes for real-time applications. Simulation results are also presented to validate the proposed approach.

A New Approach for Real Time Fault Diagnosis in Induction Motors Based on Vibration Measurement

Condition monitoring is used to increase machinery availability and machinery performance, reducing consequential damage, increasing machine life, reducing spare parts inventories, and reducing breakdown maintenance. An efficient real time vibration measurement and analysis instruments is capable of providing warning and predicting faults at early stages. In this paper, a new methodology for the implementation of vibration measurement and analysis instruments in real time based on circuit architecture mapped from a MATLAB/Simulink model is presented. In this study, signal processing applications such as FIR filters and fast Fourier transform are treated as systems, which are implemented in hardware using a system generator toolbox, which translates a Simulink model in a hardware description language - HDL for FPGA implementations.

A new method for real time computation of power quality indices based on instantaneous space phasors

One of the important issues about using renewable energy is the integration of dispersed generation in the distribution networks. Previous experience has shown that the integration of dispersed generation can improve voltage profile in the network, decrease loss, etc. but can create safety and technical problems as well. This work report the application of the instantaneous space phasors and the instantaneous complex power in observing performances of the distribution networks with dispersed generators in steady state. New IEEE apparent power definition, the so-called Buchholz-Goodhue effective apparent power, as well as new proposed power quality (oscillation) index in the three-phase distribution systems with unbalanced loads and dispersed generators, are applied. Results obtained from several case studies using IEEE 34 nodes test network are presented and discussed. (C) 2006 Elsevier B.V. All rights reserved.

Real-time multi-sensors measurement system with temperature effects compensation for impedance-based structural health monitoring

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)