163 resultados para Ferramenta de automação


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Pós-graduação em Saúde Coletiva - FMB

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Pós-graduação em Música - IA

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Pós-graduação em Engenharia Elétrica - FEIS

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Pós-graduação em Engenharia Elétrica - FEIS

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Pós-graduação em Zootecnia - FMVZ

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

O presente trabalho de conclusão de curso reporta os resultados obtidos durante o estágio de Iniciação Científica realizado no Núcleo de Biossíntese, Bioensaios e Ecofisiologia de Produtos Naturais do Departamento de Química Orgânica do Instituto de Química da UNESP-Araraquara. Foram realizados ensaios de triagem de substâncias naturais, semissintéticas e sintéticas com atividade inibitória sobre a protease aspártica pepsina e a protease serínica subtilisina. As amostras foram obtidas de extratos vegetais e de fungos endofíticos e foram testadas tanto substâncias puras naturais como diterpenos clerodânicos, cromenos, peptídeos e amidas bem como derivados sintéticos do ácido caféico, ferúlico, alcalóides piridínicos, entre outros resultantes das pesquisas realizadas por pesquisadores do NuBBE. Resultados mostraram que os ensaios de inibição da pepsina e da subtilisina apresentaram seletividade para os diferentes tipos de substâncias testadas. Ainda mais, foi possível observar diferenças nos resultados obtidos com os enantiômeros dos cromanos e dos cromenos. As substâncias que apresentaram maiores porcentagens de inibição foram os cromenos, os derivados do ácido cafeico, do ácido ferúlico e do ácido benzóico, as amidas, bem como os diterpenos clerodânicos. Alguns destes resultados foram publicados em revistas indexadas (Flausino et al., 2009; López et al., 2010; Oliveira et al., 2011) e outros estão sendo preparados para publicação

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The Rouanet law is a tax incentive law that allows companies to invest up to 4% of their taxes - based on actual profit - in sponsoring cultural projects previously approved by the Ministry of Culture. By sponsoring these projects, companies can have their name attached to them and, consequently, strengthening their brand and increase its visibility in the market. Whereas this project is aligned to the company vision, its image will be strengthened and the sales will increase. Large companies use the Rouanet Law to sponsor cultural events and have very strong names in the Brazilian market, perhaps worldwide. Examples: Petrobras, Banco do Brasil, Banco Bradesco, BNDES, Usiminas, Vale, among others. The Public Relations professional, who’s responsible for internal and external communication of a company, can use it as a differential of his work, expanding the company's profits with minimum investments, aligning the company's vision to actual practices and using the sponsorship as an agent capable of strengthen its social responsibility and, due to that, to increase the trust of its target audience. This study will address the theoretical and practical aspects of the Rouanet Law and of the public relations professionals, beyond mentioning examples on the subject, with special attention to Petrobras, the largest sponsor of cultural projects in Brazil. The greatest problem of the Rouanet Law is the fact that its sponsored projects are mostly concentrated in the Southeast, specifically in the Rio - São Paulo region. The more popular the Act become, for most places it will spread and Brazil may, after some time, become a world reference in the Cultural point

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Neste trabalho será abordada a modernização das técnicas em torno da produção agrícola e como o modo de produção familiar foi deixado de lado no que diz respeito às políticas públicas, que passou a favorecer as grandes produções agrícolas. É nesse contexto que apresentam-se as características desse tipo de agricultura e as técnicas utilizadas para mantê-la nos dias de hoje, com aplicação e análise do Diagnóstico Rural Participativo em pequenas propriedades rurais no bairro rural do Sobrado, município de Rio Claro, São Paulo que, historicamente, teve no cultivo do café a base para seu desenvolvimento político e econômico e se caracteriza por ter mais de oitenta por cento (80%) de suas terras destinadas às atividades agropastoris. Sendo assim, este trabalho corrobora a estudos relacionados à metodologia aplicada e ao desenvolvimento rural sustentável no município

Relevância:

20.00% 20.00%

Publicador:

Resumo:

CCurrently there are various systems for the evaluation of environmental impacts of buildings, known as tools of environmental certification. Among these, the tool LEED for New Construction and Major Renovations has been the most widely used and accepted worldwide, in assessing the sustainability of buildings. Therefore, this study aimed to analyze the tool for LEED certification for construction work in Brazil, which ranks fourth in the world ranking records certification of sustainable buildings. It was found in this analysis that the assumptions of this tool are encouraging the use of more sustainable and less impactful on the environment as it promotes the deployment of innovative projects from a technological standpoint, , as well as the valuation of enterprises certified. Also, very significant results obtained in terms of energy efficiency and environmental quality in occupied buildings