111 resultados para Detecção e diagnóstico de avarias


Relevância:

30.00% 30.00%

Publicador:

Resumo:

The brainstem auditory evoked potential is an electrodiagnostic test that allows a functional assessment of the auditory pathways from the middle ear to the brainstem. This test, in veterinary medicine, is not commonly used in Brazil. This paper reports the use of auditory evoked potential for deafness detection in a cat with unilateral peripheral vestibular syndrome secondary to otitis media.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Chlamydophila psittaci is a bacterium that causes respiratory or systemic disease in birds and humans. Owing to the risk of transmission from asymptomatic birds to humans, the objective of this study was to detect the presence of Chlamydophila spp. in asymptomatic birds. Four hundred and three fecal samples or cloacal swabs were collected from domestic, wild or exotic birds. The 403 samples were examined by real time PCR specific for the 16S subunit of rRNA gene using SsoFastEvaGreenSupermixTM (Bio-Rad) and melting curve analysis. Hemi-nested PCR specific for the OMP-A gene, accomplished in real-time PCR positive samples, was followed by sequencing of the amplified fragments to determine the genotype of C. psittaci. Real-time PCR was positive in 17 (4.21%) samples. Hemi-nested PCR revealed positivity in two samples previously positive by real-time PCR. Sequencing of the fragment amplified by hemi-nested PCR allowed for the identification of genotype A of C. psittaci in one sample. The results of this experiment show that the real-time PCR targeting the 16S rRNA gene followed by melting curve analysis can be used for diagnosis of Chlamydophila sp. in fecal samples of asymptomatic birds. The classification of the Chlamydophila species and the genotype of C. psittaci must be accomplished by PCR targeting the ompA gene and sequencing of the amplified fragments.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10 bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Ps-graduao em Biotecnologia - IQ

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Ps-graduao em Engenharia Eltrica - FEIS

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The feline leukemia virus (FeLV) was described in 1964 by William Jarrett and collaborators wen find viral particles attached to the membrane of lymphoblasts in cat with lymphoma. The virus belongs to the family Retroviridae, subfamily oncornavirus. With worldwide distribution, the occurrence of FeLV has 1.6% in healthy cats and 10.8% in sick cats in Brazil. The mortality of persistently viremic animals in catteries is about 50% in two years and 80% in three years. In catteries that have endemic feline Coronavirus (FCoV), FeLV and / or Feline Immunodeficiency Virus (FIV), the FeLV infection has greater contribution to mortality. The test for infection and FeLV positive cats segregation is the main way to prevent the spread of infection. The diagnostic methods are based on clinical signs and changes compatible with FeLV infection observed by physical examination, complete blood count, X-ray, bone marrow aspirate and biochemical. The viral p27 protein is produced in infected cells in high amounts and is found in abundance in the cytoplasm and in body fluids enabling diagnosed methods such as enzyme-linked immunosorbent assay - ELISA and direct immunofluorescence, detection of viral genome (Chain Reaction Polymerase - PCR) and detection of the virus by virus isolation. Although diagnostic tests are highly sensitive, it should be made more than a confirmatory test, especially serological due to variable characteristic of the progress of infection

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The modernization of image equipaments associate to the veterinary professionals qualification allowed an advance in diagnosis veterinary medicine, and, consequently, in premature pregnancy diagnosis in bitches. Currently, owners and creators search for information related to pregnancy detection, fetal development and viability and litter size determination. Through diagnosis methods as radiology and ultrasonography, associated to clinics aspects, the diagnosis of early pregnancy become more acurated and precise, allowing more quality in the accompaniment of prenatal of these bitches. Ultrasonographic exams help the accompaniment of these pregnancies through of visuals recourses, which can supply information related to pregnancy detection, embrionary and fetal development, fetal viability e litter size determination through fetals mensurations. The radiographic study has as principal indication the fetal counting, and has been the most acurated for this analyses. It may be done after the da s after the luteini ing hormone surge, when occurs the fetal mineralization. Due to its importance in the present time and in small animals clinic, the objective of this study is to discuss the main radiographics and ultrassonographics aspects of the diagnosis of pregnancy in bitches

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Canine Pyometra is a uterine disease that occurs in sexually mature bitches, with higher incidence in nulliparous and animals over 4 years and is characterized by presenting an accumulation of pus in the uterine lumen, usually occurring in diestrus. Laboratory tests are important tools for the detection of metabolic abnormalities associated with sepsis and renal function, which are serious consequences of pyometra. In blood the main findings are normochromic non-regenerative anemia, presence of dehydration, and sometimes thrombocytopenia. The WBC count may be normal but most often occurs a neutrophilic leukocytosis with a left shift, monocytosis and the presence of toxic neutrophils. In less than 1 / 3 of the animals the presence of azotemia is present and a density lower than 1035 is detected in the urine of almost 90% of bitches which may be in normal range at the onset of the desease. Urinary protein loss is rare but the protein may be elevated in the reagent strip due to urinary contamination by uterine secretion. The increase of gamma-glutamyltransferase (GGT), alkaline phosphatase (ALP), aspartate aminotransferase (AST) and creatine kinase (CK) may be present, indicating disorders in the liver. Currently, additional laboratory tests are being studied for the diagnosis of pyometra and its prognosis, such as the measurement of C-reactive protein and fibrinogen for monitoring the recovery of the inflammatory process and the urine electrophoresis to characterize the origin of proteinuria in these animals . The aim of this work is to review the literature on the main laboratory tests that aid the diagnosis of Pyometra

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Espcies do gnero Strongyloides so importantes parasitas de humanos e animais domsticos e aquelas que parasitam roedores so freqentemente utilizadas como modelos experimentais para o estudo da estrongiloidase. S. venezuelensis parasita ratos (Rattus norvegicus) e seu estudo tem permitido o entendimento de mecanismos imunolgicos envolvidos na relao parasitahospedeiro da estrongiloidase humana e animal. O diagnóstico parasitolgico de S. venezuelensis pode ser realizado pela detecção de ovos embrionados nas fezes, com o uso do OPG (ovos por grama de fezes), tambm empregado no monitoramento da infeco. Entretanto, essa tcnica se mostra pouco sensvel quando a carga parasitria leve. Os mtodos moleculares aumentam a sensibilidade e a especificidade das anlises. A PCR tem se mostrado como uma tcnica sensvel e precisa na detecção de parasitas em tecidos e fezes de hospedeiros infectados. A fim de comparar a sensibilidade das tcnicas de OPG e PCR em ratos Lewis infectados por S. venezuelensis, foram realizados dois protocolos no presente estudo. No Protocolo I foi comparada a sensibilidade das duas tcnicas em amostras de ratos Lewis com diferentes cargas parasitrias. A PCR com o emprego par de primers descrito por Dorris et al. (2002) obteve melhores resultados que o OPG nos grupos inoculados com 40 L3, considerada como infeco leve. Entretanto, no foi verificada diferena estatstica significativa entre as tcnicas (P>0,05), provavelmente por terem sido utilizados poucos animais (n=10). O outro par de primers utilizado foi desenhado a partir de uma seqncia parcial do gene do rDNA de S. venezuelensis e no foi capaz de detectar a presena do DNA do helminto em nenhuma amostra desse grupo. J nos grupos inoculados com 400 e 4000 L3, tanto a PCR com...(Resumo completo, clicar acesso eletrnico abaixo)

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The huge demand for procedures involving ionizing radiation promotes the need for safe methods of experimentation considering the danger of their biological e ects with consequent risk to humans. Brazilian's legislation prohibits experiments involving this type of radiation in humans through Decree 453 of Ministry of Health with determines that such procedures comply with the principles of justi cation, optimization and dose limitation. In this line, concurrently with the advancement of available computer processing power, computing simulations have become relevant in those situations where experimental procedures are too cost or impractical. The Monte Carlo method, created along the Manhattan Project duringWorldWar II, is a powerful strategy to simulations in computational physics. In medical physics, this technique has been extensively used with applications in diagnostics and cancer treatment. The objective of this work is to simulate the production and detection of X-rays for the energy range of diagnostic radiology, for molybdenum target, using the Geant4 toolkit. X-ray tubes with this kind of target material are used in diagnostic radiology, speci cally in mammography, one of the most used techniques for screening of breast cancer in women. During the simulations, we used di erent models for bremsstrahlung available in physical models for low energy, in situations already covered by the literature in earlier versions of Geant4. Our results show that although the physical situations seems qualitatively adequate, quantitative comparisons to available analytical data shows aws in the code of Geant4 Low Energy source

Relevância:

30.00% 30.00%

Publicador:

Resumo:

This paper deals with a case study of assessing risk to human health, with the study area of an industrial site in the city of Paulinia (SP) contaminated by oil, which is disturbing situation that occurs in the state of Sao Paulo, which represents risks for human health, as toxic and carcinogenic potential of petroleum products. As an essential foundation for risk assessment, a Geo-environmental diagnosis of the region was made, posing as historical information of the area and accidents, regional geology and hydrogeology, characterization of contaminants and affected media, contaminant transport and data on potential receptors and pathways. Because of the detection of contaminants above the intervention values CETESB (2005) it was possible to proceeded to quantify risks to human health and the determination of maximum acceptable concentrations for no damage to health, using the methodology and software RBCA Tier 2 (ASTM , 1998) and Spreadsheet Risk Assessment recently published by CETESB. The results showed the risk to the health of industrial workers and regular employees of civil works (both on site) for ingestion of groundwater and inhalation of vapors indoors.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

O Programa Nacional de Triagem Neonatal (PNTN), popularmente conhecido como Teste do Pezinho, responsvel pelo rastreamento das seguintes doenas nos recm-nascidos brasileiros: Fenilcetonria, Hipotiroidismo Congnito, Doenas Falciformes e demais Hemoglobinopatias, e Fibrose Cstica. Seu objetivo o diagnóstico precoce dessas doenas congnitas em fase assintomtica, buscando prevenir o aparecimento de sequelas neurolgicas e outras complicaes por meio do acompanhamento e tratamento adequados. O PNTN, alm de realizar o diagnóstico pr-clnico de doenas que constituem problemas de sade pblica, gera informaes que podem ser usadas em estudos epidemiolgicos fundamentais para o planejamento de programas de sade. Para que esse sistema seja completo, no entanto, necessrio haver o treinamento dos profissionais da sade envolvidos no assunto, bem como a implantao de atividades educativas para estes e para o pblico em geral. Neste contexto, este estudo retrospectivo prope investigar a relao de resultados alterados das doenas detectadas pelo PNTN entre os meses de abril e dezembro de 2009 e janeiro e dezembro de 2010 no municpio de Araraquara, verificar se as primeiras coletas de sangue esto sendo feitas segundo as recomendaes do Ministrio da Sade e capacitar agentes comunitrios da sade nesse assunto. Foram analisados 4.116 resultados. No houve diferena significativa entre as prevalncias obtidas em 2009 e 2010, ou seja, as freqncias das patologias estudadas se mantiveram praticamente constantes ao longo dos dois perodos

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Coordenao de Aperfeioamento de Pessoal de Nvel Superior (CAPES)

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Fundao de Amparo Pesquisa do Estado de So Paulo (FAPESP)

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Conselho Nacional de Desenvolvimento Cientfico e Tecnolgico (CNPq)