Microsatellite marker-based assessment of the biodiversity of native bioethanol yeast strains

Although many Brazilian sugar mills initiate the fermentation process by inoculating selected commercial Saccharomyces cerevisiae strains, the unsterile conditions of the industrial sugar cane ethanol fermentation process permit the constant entry of native yeast strains. Certain of those native strains are better adapted and tend to predominate over the initial strain, which may cause problems during fermentation. In the industrial fermentation process, yeast cells are often exposed to stressful environmental conditions, including prolonged cell recycling, ethanol toxicity and osmotic, oxidative or temperature stress. Little is known about these S. cerevisiae strains, although recent studies have demonstrated that heterogeneous genome architecture is exhibited by some selected well-adapted Brazilian indigenous yeast strains that display high performance in bioethanol fermentation. In this study, 11 microsatellite markers were used to assess the genetic diversity and population structure of the native autochthonous S. cerevisiae strains in various Brazilian sugar mills. The resulting multilocus data were used to build a similarity-based phenetic tree and to perform a Bayesian population structure analysis. The tree revealed the presence of great genetic diversity among the strains, which were arranged according to the place of origin and the collection year. The population structure analysis revealed genotypic differences among populations; in certain populations, these genotypic differences are combined to yield notably genotypically diverse individuals. The high yeast diversity observed among native S. cerevisiae strains provides new insights on the use of autochthonous high-fitness strains with industrial characteristics as starter cultures at bioethanol plants. © 2013 John Wiley & Sons, Ltd.

Acute phase protein profile in agoutis (Dasyprocta azarae; Lichtenstein, 1823) in captivity, determined by sodium dodecyl sulfate polyacrilamyde gel electrophoresis

The acute phase response refers to a nonspecific and complex systemic reaction of the organism that occurs shortly after any tissue injury. The acute phase response is considered a part of the innate host defense system, which is responsible for the survival of the host during the critical early stages of attack, and in evolutionary terms, it precedes the acquired immune response. The purpose of this study was to determine serum protein concentrations, including the acute phase protein profile in agoutis (Dasyprocta azarae) in captivity, by means of sodium dodecyl sulfate polyacrylamide gel electrophoresis. Blood samples from 11 adult healthy animals (nine females and two males) were obtained. The serum proteinogram had 21 proteins with molecular weights ranging from 15 to 240 kD. The acute phase proteins identified were: ceruloplasmin, transferrin, albumin, haptoglobin, α-1-acid glycoprotein, and hemoglobin. IgA, IgG heavy and light chains, and nonnominal identified proteins of 240, 210, 140, 98, 78, 48, 35, 31, 23, and 15 kD were also identified. The determination of the acute phase protein concentrations is a useful method for the early detection of subclinical disease or changes in the healthy animal, with predictive information on the development of disease in the future. It is possible to standardize the reference values of the serum protein profile of agoutis, which can be used for diagnosis and prognosis, treatment and clinical follow-up of nutritional disorders, and immune-mediated inflammatory diseases that may affect these animals. © 2012 Springer-Verlag London Limited.

Estudo de SNPs do cromossomo Y na população do Estado do Espirito Santo, Brasil

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Análise químico-farmacêutica de norflocacino comprimidos e estudos de complexação com β-Ciclodextrina e polimorfismo

Pós-graduação em Ciências Farmacêuticas - FCFAR

Determinação de conservantes e contaminantes em alimentos e bebidas por Eletroforese capilar

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Desenvolvimento de método para determinação de composição de atmosfera modificada pela presença de inibidores de corrosão

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Análise de ligação e associação no genoma com gagueira desenvolvimental persistente em famílias do Estado de São Paulo-Brasil

Pós-graduação em Ciências Biológicas (Genética) - IBB

Genes candidatos a marcadores tumorais na progressão do adenocarcinoma de próstata indentificados por análise de HR-CGH e CGH-ARRAY

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Análise químico-farmacêutica e estudo de estabilidade e de dissolução de cápsulas de flucloxacilina sódica

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

PCR fluorescente associada à eletroforese capilar como ferramenta de diagnóstico de bactérias no semen

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.

Avaliação da disseminação de Salmonella Senftenberg isoladas de diversos ambientes avícolas utilizando a técnica de Pulsed Field Gel Electrophoresis

Pós-graduação em Microbiologia - IBILCE

Ultrasonic non-destructive testing of plate-like structures using piezoelectric array transducers

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

A simple and rapid screening method for sulfonamides in honey using a flow injection system coupled to a liquid waveguide capillary cell

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Yield, changes in proteolysis, and sensory quality of Prato cheese produced with different coagulants

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)