78 resultados para QUANTITATIVE PCR
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
The Epstein-Barr virus (EBV) and Kaposi's sarcoma associated herpesvirus (KSHV) are consistently associated with lymphoproliferative diseases and cancers in humans, notably in patients with HIV. Our aim was to evaluate whether EBV and/or KSHV viral loads regularly assessed in peripheral blood mononuclear cells (PBMC) correlate with clinical or laboratorial parameters retrieved for patients living with HIV. This was a longitudinal study with a cohort of 157 HIV positive patients attending an academic HIV outpatient clinic in São Paulo State, Brazil. For each patient, up to four blood samples were collected over a 1 year clinical follow-up: on enrolment into the study, and after 4, 8 and 12 months. Total DNA was extracted from PBMC, and EBV and KSHV viral loads were assessed by real time quantitative PCR. Higher viral loads for EBV were significantly associated with high HIV viraemia, a greater number of circulating T CD8+ cells and lack of virological response to the antiretroviral treatment. KSHV viral load was undetectable in virtually all samples. EBV viral load in PBMC correlated with the number of circulating T CD8+ lymphocytes and the response to the antiretroviral therapy in HIV infected patients. In contrast, KSHV was undetectable in PBMC, presumably an effect of the antiretroviral treatment. Therefore, either KSHV infection in the population studied was absent or viral load in PBMC was beyond the analytical limit of the assay.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Cervical cancer is the second most frequent cancer in women worldwide and is associated with genetic alterations, infection with human papilloma virus (HPV), angiogenesis and inflammatory processes. The idea that inflammation is involved in tumorigenesis is supported by the frequent appearance of cancer in areas of chronic inflammation. On the other hand, the inflammatory response is controlled by the action of anti-inflammatory mediators, among these mediators, annexin A1 (ANXA1), a 37 kDa protein was detected as a modulator of inflammatory processes and is expressed by tumor cells. The study was carried out on the epithelial cancer cell line (SiHa) treated with the peptide of annexin A1 (ANXA1Ac2-26). We combined subtraction hybridization approach, Ingenuity Systems software and quantitative PCR, in order to evaluate gene expression influenced by ANXA1. We observed that ANXA1Ac2-26 inhibited proliferation in SiHa cells after 72h. In these cells, 55 genes exhibited changes in expression levels in response to peptide treatment. Six genes were selected and the expression results of 5 up-regulated genes (TPT1, LDHA, NCOA3, HIF1A, RAB13) and one down-regulated gene (ID1) were research by real time quantitative PCR. Four more genes (BMP4, BMPR1B, SMAD1 and SMAD4) of the ID1 pathway were investigated and only one (BMPR1B) shows the same down regulation. The data indicate the involvement of ANXA1Ac2-26 in the altered expression of genes involved in tumorigenic processes, which could potentially be applied as a therapeutic indicator of cervical cancer.
Resumo:
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)
Resumo:
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)