132 resultados para Ferramenta Electrónica
Resumo:
This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.
Resumo:
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)
Resumo:
Pós-graduação em Música - IA
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)
Resumo:
O presente trabalho de conclusão de curso reporta os resultados obtidos durante o estágio de Iniciação Científica realizado no Núcleo de Biossíntese, Bioensaios e Ecofisiologia de Produtos Naturais do Departamento de Química Orgânica do Instituto de Química da UNESP-Araraquara. Foram realizados ensaios de triagem de substâncias naturais, semissintéticas e sintéticas com atividade inibitória sobre a protease aspártica pepsina e a protease serínica subtilisina. As amostras foram obtidas de extratos vegetais e de fungos endofíticos e foram testadas tanto substâncias puras naturais como diterpenos clerodânicos, cromenos, peptídeos e amidas bem como derivados sintéticos do ácido caféico, ferúlico, alcalóides piridínicos, entre outros resultantes das pesquisas realizadas por pesquisadores do NuBBE. Resultados mostraram que os ensaios de inibição da pepsina e da subtilisina apresentaram seletividade para os diferentes tipos de substâncias testadas. Ainda mais, foi possível observar diferenças nos resultados obtidos com os enantiômeros dos cromanos e dos cromenos. As substâncias que apresentaram maiores porcentagens de inibição foram os cromenos, os derivados do ácido cafeico, do ácido ferúlico e do ácido benzóico, as amidas, bem como os diterpenos clerodânicos. Alguns destes resultados foram publicados em revistas indexadas (Flausino et al., 2009; López et al., 2010; Oliveira et al., 2011) e outros estão sendo preparados para publicação
Resumo:
The Rouanet law is a tax incentive law that allows companies to invest up to 4% of their taxes - based on actual profit - in sponsoring cultural projects previously approved by the Ministry of Culture. By sponsoring these projects, companies can have their name attached to them and, consequently, strengthening their brand and increase its visibility in the market. Whereas this project is aligned to the company vision, its image will be strengthened and the sales will increase. Large companies use the Rouanet Law to sponsor cultural events and have very strong names in the Brazilian market, perhaps worldwide. Examples: Petrobras, Banco do Brasil, Banco Bradesco, BNDES, Usiminas, Vale, among others. The Public Relations professional, who’s responsible for internal and external communication of a company, can use it as a differential of his work, expanding the company's profits with minimum investments, aligning the company's vision to actual practices and using the sponsorship as an agent capable of strengthen its social responsibility and, due to that, to increase the trust of its target audience. This study will address the theoretical and practical aspects of the Rouanet Law and of the public relations professionals, beyond mentioning examples on the subject, with special attention to Petrobras, the largest sponsor of cultural projects in Brazil. The greatest problem of the Rouanet Law is the fact that its sponsored projects are mostly concentrated in the Southeast, specifically in the Rio - São Paulo region. The more popular the Act become, for most places it will spread and Brazil may, after some time, become a world reference in the Cultural point
Resumo:
Neste trabalho será abordada a modernização das técnicas em torno da produção agrícola e como o modo de produção familiar foi deixado de lado no que diz respeito às políticas públicas, que passou a favorecer as grandes produções agrícolas. É nesse contexto que apresentam-se as características desse tipo de agricultura e as técnicas utilizadas para mantê-la nos dias de hoje, com aplicação e análise do Diagnóstico Rural Participativo em pequenas propriedades rurais no bairro rural do Sobrado, município de Rio Claro, São Paulo que, historicamente, teve no cultivo do café a base para seu desenvolvimento político e econômico e se caracteriza por ter mais de oitenta por cento (80%) de suas terras destinadas às atividades agropastoris. Sendo assim, este trabalho corrobora a estudos relacionados à metodologia aplicada e ao desenvolvimento rural sustentável no município
Resumo:
CCurrently there are various systems for the evaluation of environmental impacts of buildings, known as tools of environmental certification. Among these, the tool LEED for New Construction and Major Renovations has been the most widely used and accepted worldwide, in assessing the sustainability of buildings. Therefore, this study aimed to analyze the tool for LEED certification for construction work in Brazil, which ranks fourth in the world ranking records certification of sustainable buildings. It was found in this analysis that the assumptions of this tool are encouraging the use of more sustainable and less impactful on the environment as it promotes the deployment of innovative projects from a technological standpoint, , as well as the valuation of enterprises certified. Also, very significant results obtained in terms of energy efficiency and environmental quality in occupied buildings
Resumo:
Formigas do gênero Linepithema se encontram distribuídas amplamente por todo o globo, algumas delas, como Linepithema humile são muito conhecidas por sua ação invasora, comprometendo fauna e flora dos ambientes que invadem. Devido a notoriedade dessa espécie, há uma tendência em identificar erroneamente como L. humile as espécies próximas. Assim ocorreu com outras espécies da região Sul do Brasil com características próximas a ela. L. micans é a principal espécie que se associa com a pérola-da-terra Eurhizococcus brasiliensis (Hemíptera: Margarodidae), importante praga na vinicultura gaúcha. Análises preliminares revelaram a existência de três subtipos de L. micans. No presente estudo foram analisadas diferentes populações de L. micans das vinícolas do Estado do Rio Grande do Sul com a utilização de dois genes mitocondriais, utilizados para DNA Barcode de animais, com o propósito de estabelecer a distribuição dos diferentes mitótipos de L. micans. O resultado obtido revelou a existência de 14 haplótipos, sendo 12 novos e a análise da rede de haplótipos sugere a existência de dois possíveis grupos ancestrais
Resumo:
Technological development in the IT and telecommunications sectors have transformed the way organizations communicate with their audiences. Social Media allow the exchange of information instantaneously, in a communication from many to many. With few studies in the area, many companies venture into the social media without a strategy and a generally end up denigrating their image itself. Thus, this study was conceived from the idea of contributing, analytically, based on the main concepts of Public Relations so the organizations effectively take advantage of their online presence to generate relationships, more specifically, on Twitter.Twitter is a social media with a mature public, requiring dynamics of information and quick answers, based on dialogue, referring to the idea of text messages (SMS). To better expose the results of this research, three organizations with expertise in twitter were chosen: Bradesco , Positivo Informática and Ponto Frio. The choice of case studies was based on the different segments that each one operates and that they are large companies with reputable commercial operations in the Brazilian scenario. To analyze their profiles, several authors were studied, like Fábio França, Maria Aparecida Ferrari, Margarida Kunsch e Marlene Machiori.The intent of the analysis of the Twitter profiles of these organizations is to understand whether they are using strategies for creating and maintaining relationships with your followers and how this occurs from specific categories, as other companies have committed serious errors and impairing their business because of mismanagement in social media. Therefore, the profiles were analyzed from the netnográfica methodology. As a result, it was observed that organizations have not yet developed the character of relationships in social media , treating this channel as another advertising channel It was observed that Positivo Informática has no specific strategy for Twitter...
Resumo:
Currently, due to the highly competitive search among industries are becoming more tools for managing product that provides higher availability and therefore profitability. Maintenance as a strategic sector and of fundamental importance in business, it seeks to maximize availability and available resources, minimizing costs and waste, which directly impacts the company's results. The present work has as main objective the review of contracts for maintenance services for companies contracted by a chemical company in the Paraíba Valley, since most of its maintenance services are outsourced, and raise these contracts which are more critical and higher risk to the company's success, thus creating a tool for decision-making by maintenance managers in the act of seeking renewals or new contracts to provide services. As a result after drawing up a standard procedure for contracting of services and a better structuring of the same, we developed a method for the calculation of the criticality of the contracts and based on these calculations, charts were prepared which showed that the current scenario of maintenance contracts the company studied. Thus it is possible to evaluate the contracts which are most critical to the success or failure of the company studied, and also pave the way for further studies on how this criticality of a contract can affect the relationship, the contractor x contracted
Resumo:
This research focuses on methods and strategies for educational-based digital tools, aimed at the public school. Thus, we present possibilities, and the main actions of the national museum institutions in several online educational services that exemplify some forms of virtual mediation in order to verify the relevance of using these tools. The study discusses the need for museums to follow the advance of new technologies to engage and retain the public school, consisting of a highly connected generation with new technologies. It also brings a brief overview of the evolution of the museum in the Western world and presents the formation and nature of art collections that comprise the Artistic-Cultural Collection of the Governmental Palaces of the State of São Paulo, focusing on the management policy of each period, highlighting the educational program and the relationship with the website. As a practical exercise, the research presented suggests applying a form of mediation for the virtual site of Artistic-Cultural Collection of the Governmental Palaces to extend relations sector educational institution for the virtual context
Resumo:
The present study is about data characterization and evaluation related to private urban users (legal entity) of the Watersheds of the rivers Piracicaba, Capivari, and Jundiai (PCJ), with the PCJ Collection System, sustained by the Department of Water and Power (DAEE), in order to: provide quantitative numbers about this sector, identifying the cities and economic activities corresponding to the largest water consumers, and determine the sector's share in the total charged contribution. The charge for water use is the most recent and the last instrument which has been implemented for the management of water resources, provided by the institution of the State and National Policy of Water Resources in 1991 and 1997, respectively, regarded as an important step towards the preservation and restoration of water resources. According to the data collected in the PCJ Collection System, the urban sector is the private sector that has the highest number of users in these watersheds (52,95% of users), but with less representation in the financial recovery (only 7%), due to its low water demand in their uses compared to the uses of other sectors. The collected data will also serve as both a parameter for comparing the amount of water used by different economic activities and municipalities in the PCJ watersheds and other locations, and as a tool for water resources management
Resumo:
The growing demand for quality at competitive prices and fast production process put to the test function in the industrial Maintenance. The need for equipment with high availability to fit this fierce competitiveness makes maintenance becomes essentially reliable. Despite this current context, many companies still have an old view of maintenance, focused only on corrective services, and proposals for change are often neglected due to the sense of urgency day to day. Thus, this study aims to demonstrate through theoretical applicability of simple tool, but of great value in increasing reliability within the maintenance sector of an industry, applying the concepts of Reliability Centered Maintenance – RCM and Analysis tool Failure Modes and Effects – FMEA in equipment of a chemical company directly involved in the manufacturing process of the brake fluid, which this product is used in vehicles around the country. That way, you can identify the types, occurrence and criticality of each failure and evaluate assertively decision making for each device, avoiding unnecessary downtime and potential failures of the same