Expression of MyoD, myogenin, myostatin and Hsp70 transcripts in chicken embryos submitted to mild cold or heat

The expression of the MyoD, myogenin, myostatin and Hsp70 genes was estimated in chicken embryos submitted to mild cold (36 +/- 0.5degreesC) or heat (44 +/- 0.5degreesC) for 1 h. 2. Marked decreases in MyoD, myogenin and myostatin transcript levels were observed in embryos exposed to high temperature, contrasting to the higher expression of the Hsp70 mRNA detected in heat-stressed embryos. 3. The exposure of chicken embryos to low temperature significantly affected only the abundance of myogenin mRNA. 4. These findings suggest that myogenic proliferation and differentiation events are compromised by variations in environmental temperature during avian embryogenesis. (C) 2003 Elsevier B.V. Ltd. All rights reserved.

Brain and hepatic Hsp70 protein levels in heat-acclimated broiler chickens during heat stress

In the present study we have investigated the effects of heat acclimation on brain and hepatic Hsp70 protein levels and body temperature of broiler chickens in response to gradual heat stress. Two groups of broilers were raised up to 47 days of age under distinct temperature conditions: thermoneutral (TN, according to bird age) or hot environmental (HS, 31-33°C). At 46 days of age, the birds reared at high ambient temperature were transferred to thermoneutrality conditions. After 18 h, these birds and the birds reared at thermoneutral temperature were submitted to gradual heat stress in a climatic chamber so that environment temperature was increased from 28 to 40ºC at a rate of 2ºC/h. Colonic temperature was measured using a thermometer sensor probe at each two hours, and hepatic and brain tissues were collected immediately after slaughter in order to assess Hsp70 protein level by Western blotting analysis. The colonic temperatures of birds reared at high temperature increased steeply during the first 2 h of heat stress (1.06ºC/h) and more slowly thereafter (0.59ºC/h). Broilers reared at thermoneutral temperature showed a small increase in the first 4 h of heat stress (0.18ºC/h) and then colonic temperature increased sharply (0.72ºC/h). Nevertheless, both groups presented similar final colonic temperature by the end of the stress period. Hsp70 levels (ng Hsp70 µg total protein-1) did not change in the liver or brain of the birds reared at high temperature. on the other hand, both liver and brain Hsp70 levels increased significantly during heat stress in the animals reared at thermoneutrality, with a higher expression of this peptide in brain tissue.

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Cigarette smoke exposure severely reduces peripheral insulin sensitivity without changing GLUT4 expression in oxidative muscle of Wistar rats

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Heart failure alters matrix metalloproteinase gene expression and activity in rat skeletal muscle

Heart failure is associated with a skeletal muscle myopathy with cellular and extracellular alterations. The hypothesis of this investigation is that extracellular changes may be associated with enhanced mRNA expression and activity of matrix metalloproteinases (MMP). We examined MMP mRNA expression and MMP activity in Soleus (SOL), extensor digitorum longus (EDL), and diaphragm (DIA) muscles of young Wistar rat with monocrotaline-induced heart failure. Rats injected with saline served as age-matched controls. MMP2 and MMP9 mRNA contents were determined by RT-PCR and MMP activity by electrophoresis in gelatin-containing polyacrylamide gels in the presence of SDS under non-reducing conditions. Heart failure increased MMP9 mRNA expression and activity in SOL, EDL and DIA and MMP2 mRNA expression in DIA. These results suggest that MMP changes may contribute to the skeletal muscle myopathy during heart failure.

Triiodothyronine (T3) does not induce RANKL expression in rat ROS 17/2.8 cells

Osteoclastogenesis may be regulated via activation of the RANK/RANKL (receptor activator of nuclear factor-kappa B/ receptor activator of nuclear factor-kappa B ligand) system, which is mediated by osteoblasts. However, the bone loss mechanism induced by T3 (triiodothyronine) is still controversial. In this study, osteoblastic lineage rat cells (ROS 17/2.8) were treated with T3 (10(-8) M 10(-9) 10 M, and 10(-10) M), and RANKL mRNA (messenger RNA) expression was measured by semiquantitative RT-PCR. Our results show that T3 concentrations used did not significantly enhance RANKL expression compared to controls without hormone treatment. This data suggests that other mechanisms, unrelated to the RANK/RANKL system, might be to activate osteoclast differentiation in these cells.

Influence of Helicobacter pylori infection on the expression of MLH1 and MGMT in patients with chronic gastritis and gastric cancer

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Tamoxifen inhibits transforming growth factor-alpha gene expression in human breast carcinoma samples treated with triiodothyronine

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Interleukin 18 messenger RNA and proIL-18 protein expression in chorioamniotic membranes from pregnant women with preterm prelabor rupture of membranes

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Expression of beta defensins 1, 3 and 4 in chorioamniotic membranes of preterm pregnancies complicated by chorioamnionitis

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Inflammatory cytokine mRNA detection by real time PCR in chorioamniotic membranes from pregnant women with preterm premature rupture of membranes

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

TRAIL-R3-related apoptosis: Epigenetic and expression analyses in women with ovarian neoplasia

Objective. To assess the expression of TRAIL-R3 and the methylation of a CpG island within the TRAIL-R3 promoter both in cystadenoma tumors and primary and metastatic epithelial ovarian carcinoma (EOC).Methods. RNA was obtained from women with normal ovarian (NO) tissues (n = 18), ovarian serous cystadenoma tumors (n = 11) and EOC (n = 16) using Trizol (R). Quantitative PCR (gRT-PCR) was performed to quantify the relative levels of TRAIL-R3. The methylation frequency of the CpG island in the TRAIL-R3 promoter was assessed using the methylation-specific PCR (MSP) assay after DNA bisulfite conversion. The differences between the groups were evaluated using the chi-square, Student's t, ANOVA, Mann-Whitney U, Wilcoxon or Kruskal-Wallis tests as indicated. The survival rates were calculated using the Kaplan-Meier method.Results. Cystadenoma and metastatic EOC tumors expressed significantly more TRAIL-R3 mRNA than primary EOC tumors. Methylation of the TRAIL-R3 promoter was absent in NO tissues, while hemimethylation of the TRAIL-R3 promoter was frequently found in the neoplasia samples with 45.4% of the cystadenoma tumors, 8.3% of the primary EOC samples and 11.1% of the metastatic EOC samples showing at least partial methylation (p = 0.018). Neither the expression of TRAIL-R3 nor alterations in the methylation profile were associated to cumulative progression-free survival or the overall survival in EOC patients.Conclusions. Primary EOC is associated to a lower TRAIL-R3 expression, which leads to a better understanding of the complex disease and highlighting potential therapeutic targets. Promoter DNA methylation was not related to this finding, suggesting the presence of other mechanisms to transcriptional control. (C) 2012 Elsevier B.V. All rights reserved.

Agaricus blazei (Himematsutake) does not alter the development of rat diethylnitrosamine-initiated hepatic preneoplastic foci

The modifying potential of crude extracts of the mushroom Agaricus blazei Murrill (Himematsutake) on the development and growth of glutathione S-transferase placental form (GST-P)-positive liver foci (liver preneoplastic lesion) was investigated in adult male Wistar rats. Six groups of animals were used. Groups 2 to 5 were given a single i.p. injection of 200 mg/kg b.w. of diethylnitrosamine (DEN) and groups 1 and 6 were treated with saline at the beginning of the experiment. After 2 weeks, animals of groups 3 to 6 were orally treated with three dose levels of aqueous extracts of the mushroom A. blazei (1.2, 5.6, 11.5, and 11.5 mg/ml of dry weight of solids) for 6 weeks. All animals were subjected to two-thirds partial hepatectomy at week 3 and sacrificed at week 8. Two hours before sacrifice, ten animals of each group were administered a single i.p injection of 100 mg/kg of bromodeoxyuridine (BrdU). Apoptotic bodies and BrdU-positive hepatocyte nuclei were quantified in liver sections stained for hematoxylin and eosin (H&E) (eosinophilic foci) and simultaneously stained for GST-P expression (GST-P-positive foci), respectively. The 6-week treatment with A. blazei did not alter the development (number and size) of GST-P-positive foci and did not affect the growth kinetics of liver normal parenchyma or foci in DEN-initiated animals. Our results indicate that the treatment with aqueous extracts of the mushroom A. blazei during the post-initiation stage of rat liver carcinogenesis does not exert any protective effect against the development of GST-P-positive foci induced by DEN. (Cancer Sci 2003; 94: 188-192).

Evaluation of estrogen receptor alpha and beta and progesterone receptor expression and correlation with clinicopathologic factors and proliferative marker Ki-67 in breast cancers

To elucidate the molecular profile of hormonal steroid receptor status, we analyzed ER-alpha, ER-beta, and PGR mRNA and protein expression in 80 breast carcinomas using reverse transcriptase polymerase chain reaction (RT-PCR), quantitative RT-PCR, and immunohistochemical analysis. Qualitative analysis revealed positive expression of ER-alpha, ER-beta, and PGR mRNA in 48%, 59%, and 48% of the breast carcinomas, respectively. ER-alpha, ER-beta, and PGR transcript overexpression was observed in 51%, 0%, and 12% of the cases, respectively, whereas moderate or strong protein expression was detected in 68%, 78%, and 49% of the cases, respectively. Tumor grade was negatively correlated with transcript and protein levels of ER-alpha (P = .0169 and P = .0006, respectively) and PGR (P = .0034 and P = .0005, respectively). Similarly, proliferative index Ki-67 was negatively associated with transcript and protein levels of ER-alpha (P = .0006 and P < .0001, respectively) and PGR (P = .0258 and P =. 0005, respectively). These findings suggest that ER-alpha and PGR expression are associated with well-differentiated breast tumors and less directly related to cell proliferation. A significant statistical difference was observed between lymph node status and ER-beta protein expression (P = .0208). In ER-alpha-negative tumors, we detected a correlation between ER-beta protein expression and high levels of Ki-67. These data suggest that ER-beta could be a prognostic marker in human breast cancer. (C) 2008 Elsevier B.V. All rights reserved.

Expression of genes related to apoptosis, cell cycle and signaling pathways are independent of TP53 status in urinary bladder cancer cells

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)