Photodegradation of sparfloxacin and isolation of its degradation products by preparative HPLC

Sparfloxacin, a third generation fluoroquinolone derivative, is a potent antibacterial agent active against a wide range of Gram-positive and Gram-negative organisms including Streptococcus pneuinoniae, Staphylococcus aureus, methicillin resistant S. aureus, Legionella spp., Mycoplasina spp., Chlamydia spp. and Mycobacterium spp. A drawback of fluoroquinolones is their photoreactivity. Sparfloxacin has been studied in terms of therapeutic activities. However, there are few published of analytical methods being applied to sparfloxacin. The aim in this study was to determine the photodegradation products of sparfloxacin, when submitted to UV light, and to characterize two of these products, designated SPAX-PDP1 and SPAX-PDP2. An accelerated study of stability in methanol solution was carried out by exposing a solution of sparfloxacin to UV light (peak wavelength 290 nm) for 36 hours at room temperature. The products were analyzed by NMR spectrophotometry, IR spectrometry and mass spectrophotometry. The results suggest that the products isolated here could be used to estimate the degradation of sparfloxacin in a stability study. However, the low activity exhibited by UV-irradiated sparfloxacin is a source of concern that demands further investigation of the mechanism of its photodegradation mechanism.

Photodegradation of soluble and emulsive cutting fluids using TiO 2 as catalyst

This paper describes results of the photo-degradation of three types of soluble and emulsive cutting fluids in an aqueous medium, using TiO2 as catalyst in suspension and UV radiation. The TiO2 proved to be an effective catalyst for the degradation of the cutting fluids investigated. The degradation rate depends on pH and nature of the fluids. The best performance of catalyst was observed at pH 8.0 for all the fluids when most of 70% of the organic load was decomposed. ©2006 Sociedade Brasileira de Química.

Environmental ageing studies of chemically modified micro and nanofibril phenol formaldehyde composites

Cellulose micro and nano fibrils were extracted from banana macro fibres and chemically modified using sodium hydroxide, formic acid, 3-methacryloxy propyltrimethoxy silane. These untreated and chemically treated fibrils were incorporated into PF resin and the specimens were prepared. The composites were subjected to long-term water ageing, thermal ageing soil burial and outdoor weathering. The mechanical properties are reduced under all ageing conditions. The present study investigates the effects of different types of ageing on macro fibre, microfibril and nanofibril reinforced PF composites. The effect of chemical modifications of fibres on the degradability of the composites at different environments also has been analysed. © 2013 Elsevier B.V.

Low tungsten content of nanostructured material supported on carbon for the degradation of phenol

A comparative study using different mass proportions of WO3/C (1%, 5%, 10% and 15%) for H2O2 electrogeneration and subsequent phenol degradation was performed. To include the influence of the carbon substrate and the preparation methods, all synthesis parameters were evaluated. The WO3/C materials were prepared by a modified polymeric precursor method (PPM) and the sol-gel method (SGM) on Vulcan XC 72R and Printex L6 carbon supports, verifying the most efficient metal/carbon proportion. The materials were physically characterized by X-ray diffraction (XRD) and by X-ray photoelectron spectroscopy (XPS) techniques. The XRD and the XPS techniques identified just one phase containing WO3 and elevated oxygen concentration on carbon with the presence of WO3. The oxygen reduction reaction (ORR), studied by the rotating ring-disk electrode technique, showed that WO3/C material with the lowest tungsten content (1% WO3/C), supported on Vulcan XC 72R and prepared by SGM, was the most promising electrocatalyst for H2O2 electrogeneration. This material was then analyzed using a gas diffusion electrode (GDE) and 585mgL-1 of H2O2 was produced in acid media. This GDE was employed as a working electrode in an electrochemical cell to promote phenol degradation by an advanced oxidative process. The most efficient method applied was the photo-electro-Fenton; this method allowed for 65% degradation and 11% mineralization of phenol during a 2-h period. Following 12h of exhaustive electrolysis using the photo-electro-Fenton method, the total degradation of phenol was observed after 4h and the mineralization of phenol approached 75% after 12h. © 2013 Elsevier B.V.

Degradação de poluentes orgânicos utilizando filmes de TiO2 modificados com íons prata

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Antioxidant activity and determination of total phenol contents, carotenoids, beta-carotene, lycopene and zinc in white, yellow and pinkish varieties of manihot esculenta crantz

There are cassava varieties that present compounds as carotenoids, beta-carotene, lycopene and minerals important for human and animal health. The present study evaluated the antioxidant activity of the white, yellow and pinkish varieties of Manihot esculenta, by mean of the DPPH test and by the ferrous ion-chelating activity. Furthermore, the total phenols, carotenoids, beta-carotene, lycopene and zinc contents were also determined. Utilizing the DPPH test it was possible to find that extracts of boiled samples presented higher antioxidant activity (89.53% -pinkish) in comparison to the fresh samples (1.97% -white). For the ferrous ion-chelating test, the highest activity was found for the boiled pinkish variety extract (63.43%) and the lowest was for fresh yellow extract (17.34%) the white sample did not present activity. The highest concentration of total phenols and zinc content was obtained for the boiled pinkish variety extract 136.12 mg EAG/g of extract and 0,811ppm, respectively, in the concentration of 1000 mu g/mL. The pinkish variety presented also higher quantity of pigments, including carotenoid (29.40 mu g/g), beta-carotene (9.14 mu g/100g) and lycopene (68.92%). According to the results obtained in this study it was possible to conclude that the yellow and pinkish varieties of M. esculenta present quantity of phenolic compounds and minerals sufficient to attribute the antioxidant activity and may thus contribute to reduce oxidative damage and be used as nutraceuticals or directly ingested in the diet to maintain good health.

Genotoxic effect of phenol on the cells of onion (Allium cepa ) roots

The roots of onion (Allium cepa ) stand out for having cells with large size and small number of chromosomes. These characteristics make them useful in bioassays for the measurement of a variety of cytogenetic and morphological parameters, in which they can be used as toxicity indicators of the induction and formation of micronuclei and chromosomal aberrations. Based on this background, the potential genotoxic effect of phenol concentration on cells of A. cepa roots was investigated either in terms of induced aberrations or micronuclei formation. The results demonstrated that the higher the concentration of phenol, the higher the incidence of abnormalities, thus confirming the genotoxicity of this pollutant.

Phenol oxidation by mushroom waste extracts: a kinetic and thermodynamic study

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Comparison of DNA-extraction methods and Selective Enrichment broths on the detection of Salmonella Typhimurium in swine feces by polymerase chain reaction (PCR)

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Efeito do silício na preferência para oviposição de Bemisia tabaci biótipo B (Genn.) (Hemiptera: Aleyrodidae) em plantas de feijão (Phaseolus vulgaris L.)

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

DNA extraction from hair shafts of wild Brazilian felids and canids

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

The influence of preparation method of OC1OC6-PPV films on the photo-oxidation process

Poly(p-phenylene vinylene) (PPV) derivatives are well known for their applications in polymer light emitting diodes (PLEDs). PPV derivatives are highly susceptible to photo-oxidation though, which is mainly caused by the scission of the vinyl double bond on the polymer backbone. In this work, we show that Langmuir-Blodgett (LB) films are less degraded than cast films of a PPV derivative (OC1OC6-PPV). Both films had similar thickness (similar to 50 nm) to allow for a more realistic comparison. Degradation was monitored with UV-vis and FTIR spectroscopies. The results indicated that cast films were completely degraded in ca. 400 min, while LB took longer time, i.e. about four times the values for the cast films. The differences can be attributed to the more compact morphology in the LB than in the cast films. With a compact morphology the diffusion of oxygen in the LB film is hampered and this causes a delay in the degradation process. (c) 2006 Elsevier Ltd. All rights reserved.

Biomimetic biosensor based on lipidic layers containing tyrosinase and lutetium bisphthalocyanine for the detection of antioxidants

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Anti-Helicobacter pylori activity and immunostimulatory effect of extracts from Byrsonima crassa Nied. (Malpighiaceae)

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)