174 resultados para TNF-ALFA
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)
Resumo:
No presente trabalho, foram utilizadas 21 fêmeas suínas, virgens, sexualmente aptas, criadas e mantidas sob condições industriais, para observação dos perfis hormonais séricos de 17-alfa-OH progesterona e androstenediona, durante o ciclo estral. As colheitas de sangue foram efetuadas sempre no mesmo intervalo, entre 8 e 10 horas. Cada animal foi submetido a 14 punções venosas, distribuídas nos dias zero, 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 21, 22 e 23 do ciclo estral. Considerou-se o dia zero como o primeiro dia da fase estral, e o 23º dia como o primeiro do estro subseqüente. Os ensaios para dosagens hormonais foram executados utilizando-se a técnica de radioimunoensaio (RIE) em fase sólida e para isso foi empregado conjunto de reagentes comerciais (Coat-A-Count®). Para o hormônio 17-alfa-OH progesterona, foram encontrados valores médios que variaram entre 0,18 e 2,7 ng/ml e para o hormônio androstenediona esses valores oscilaram entre 0,08 e 0,24 ng/ml.
Resumo:
Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
In this study, the effect of Yersinia derivatives on nitric oxide (NO), hydrogen peroxide (H2O2) and tumor necrosis factor-alpha (TNF-alpha) production by murine peritoneal macrophages was investigated. Addition of lipopolysaccharide (LPS) to the macrophage culture resulted in NO production that was dose dependent. on the other hand, bacterial cellular extract (CE) and Yersinia outer proteins (Yops) had no effect on NO production. The possible inhibitory effect of Yops on macrophage cultures stimulated with LPS was investigated. Yops partially inhibited NO production (67.4%) when compared with aminoguanidine. The effects of Yersinia derivatives on H2O2 production by macrophages were similar to those on NO production. LPS was the only derivative that stimulated H2O2 release in a dose-dependent manner. All Yersinia derivatives provoked the production of TNF-alpha, but LPS had the strongest effect, as observed for NO production. CE and Yops stimulated TNF-alpha production to a lesser extent than LPS. The results indicate the possibility that in vivo Yops may aid the evasion of the bacteria from the host defense mechanism by impairing the secretion of NO by macrophages. (C) 2003 Elsevier SAS. All rights reserved.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Paracoccidioidomycosis, a deep mycosis endemic in Latin America, is a chronic granulomatous disease caused by the fungus Paracoccidioides brasiliensis. Phagocytic cells play a critical role against the fungus and several papers show the effects of activator and suppressive cytokines on macrophage and monocyte functions. However, the studies focusing on polymorphonuclear neutrophils (PMNs) antifungal functions are scarcer. Thus, the objective of the present paper was to assess the capacity of human PMNs to kill virulent P brasiliensis strain in vitro, before and after priming with different cytokines. Moreover, the involvement of oxygen metabolites in this activity was evaluated. Nonactivated cells failed to exhibit antifungal activity. However, when these cells were IFN-gamma, TNF-alpha or GM-CSF activated, a significative fungicidal activity was detected. This process was significantly inhibited when P brasiliensis challenge occurred in presence of catalase (CAT - a scavenger of H2O2) and superoxide dismutase (SOD - a scavenger of superoxide anion). From these results it is concluded that cytokines activation is required for P brasiliensis killing by human PMNs, and that H2O2 and Superoxide anion participate as effectors molecules in this process.
Resumo:
Paracoccidioidomycosis is a deep mycosis, endemic in Latin America, caused by Paracoccidioides brasiliensis. Macrophage activation by cytokines is the major effector mechanism against this fungus. This work aimed at a better understanding of the interaction between yeast cells-murine peritoneal macrophages and the cytokine signals required for the effective killing of high virulence yeast-form of P. brasiliensis. In addition, the killing effector mechanisms dependent on the generation of reactive oxygen or nitrogen intermediates were investigated. Cell preincubation with IFN-gamma or TNF-alpha, at adequate doses, resulted in effective yeast killing as demonstrated in short-term (4-h) assays. Both, IFN-gamma and TNF-alpha activation were associated with higher levels of H(2)O(2) and NO when compared to nonactivation. Treatment with catalase (CAT), a H(2)O(2) scavenger, and N(G)-monomethyl-L-arginine (L-NMMA), a nitric oxide synthase inhibitor, reverted the killing effect of activated cells. Taken together, these results suggest that both oxygen and L-arginine-nitric oxide pathways play a role in the killing of highly virulent P. brasiliensis.
Resumo:
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)
Resumo:
OBJETIVO: Analisar o padrão de citocinas pró- e antiinflamatórias e da resposta de fase aguda (RFA) como marcadores de resposta ao tratamento da tuberculose pulmonar. MÉTODOS: Determinação dos níveis de interferon-gama (IFN-γ), tumor necrosis factor-alpha (TNF-α, fator de necrose tumoral-alfa), interleucina-10 (IL-10) e transforming growth factor-beta (TGF-β, fator transformador de crescimento-beta), pelo método ELISA, em sobrenadante de cultura de células mononucleares do sangue periférico e monócitos, assim como dos níveis de proteínas totais, albumina, globulinas, alfa-1-glicoproteína ácida (AGA), proteína C reativa (PCR) e velocidade de hemossedimentação (VHS) em 28 doentes com tuberculose pulmonar, em três tempos: antes (T0), aos três meses (T3) e aos seis meses (T6) de tratamento, em relação aos controles saudáveis, em um único tempo. RESULTADOS: Os pacientes apresentaram valores maiores de citocinas e RFA que os controles em T0, com diminuição em T3 e diminuição (TNF-α, IL-10, TGF-β, AGA e VHS) ou normalização (IFN-γ e PCR) em T6. CONCLUSÕES: PCR, AGA e VHS são possíveis marcadores para auxiliar no diagnóstico de tuberculose pulmonar e na indicação de tratamento de indivíduos com baciloscopia negativa; PCR (T0 > T3 > T6 = referência) pode também ser marcador de resposta ao tratamento. Antes do tratamento, o perfil Th0 (IFN-γ, IL-10, TNF-α e TGF-β), indutor de e protetor contra inflamação, prevaleceu nos pacientes; em T6, prevaleceu o perfil Th2 (IL-10, TNF-α e TGF-β), protetor contra efeito nocivo pró-inflamatório do TNF-α ainda presente. O comportamento do IFN-γ (T0 > T3 > T6 = controle) sugere sua utilização como marcador de resposta ao tratamento.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
We investigated the production of interleukin-6 (IL-6) and tumor necrosis factor-alpha (TNF-alpha) during canine visceral leishmaniasis (VL) to gain a better understanding of the role of such multi-functional cytokines in parasite resistance. IL-6 and TNF-alpha levels were measured by capture ELISA in sera from 8 healthy dogs from a non-endemic area (control group) and in sera from 16 dogs from Aracatuba, SP, Brazil, an area endemic for leishmaniosis. The dogs from the endemic area were selected by positive ELISA serology against total Leishmania chagasi antigen, positive spleen imprints for Leishmania, and the presence of at least three clinical signs associated with active visceral leishmaniasis (fever, dermatitis, lymphoadenopathy, onychogryphosis, weight loss, cachexia, locomotory difficulty, conjunctivitis, epistaxis, hepatosplenomegaly, edema, and apathy).Enhanced systemic IL-6 production was found in sera from dogs with the active disease compared to healthy dogs (t-test, P < 0.05). In contrast, TNF-alpha did not differ between the two groups studied. There was no correlation between IL-6 production and anti-leishmanial antibody titers in the sera. Our findings suggest that IL-6 is a good marker of active disease during leishmaniasis, and that other cytokines may be involved in the hypergammaglobulinemia characteristic of canine visceral leishmaniasis. (c) 2006 Published by Elsevier B.V.