Effect of Resin Cement Type on the Microtensile Bond Strength to Lithium Disilicate Ceramic and Dentin Using Different Test Assemblies

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Microwave-assisted hydrothermal synthesis of magnetite nanoparticles with potential use as anode in lithium ion batteries

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Effects of lithium on the proliferation and migration of neuroblasts in the rostral migratory stream in adult mice

The discovery of neurogenesis in adult brains opened the possibility of cellular therapy strategies for the treatment of neurodegenerative diseases, such as Alzheimer’s disease. Neurogenesis in the adult brain occurs in two areas: subgranular zone of the hippocampus and subventricular zone (SVZ) of the lateral ventricles. Neurons that originate from the SVZ migrate to the olfactory bulb (OB) through the rostral migratory stream (RMS). In Alzheimer’s disease, there is a progressive neuronal dysfunction and degeneration, resulting in brain atrophy and cognitive impairments including olfactory dysfunction. Several studies have demonstrated that pharmacological treatment with lithium exerts positive effects on adult neurogenesis, and one pathway seems to be the modulation of factors that regulate the migration of neuroblasts. The objective of this study was to investigate whether treatment with lithium promotes the increase of migratory neuroblasts using as parameter the RMS. Adult male C57BL/6 mice were divided into control and lithium-treated groups. The animals were treated for 6 weeks and, at four different time points, i.e., 10 days, 7 days, 3 days and 1 day before the end of treatments, they received an injection of BrdU (cell proliferation marker). The animals were sacrificed by perfusion fixation and the brains were immunohistochemically labeled for BrdU for analysis of migrating neuroblasts in the RMS. The results showed that the number of BrdU+ cells in the RMS was not significantly different between the two groups, suggesting that lithium, alone, is not capable of increasing the number of neuroblasts migrating from the SVZ to the OB

Surface degradation of lithium disilicate ceramic after immersion in acid and fluoride solutions

Purpose: To analyze whether immersion in sodium fluoride (NaF) solutions and/or common acidic beverages (test solutions) would affect the surface roughness or topography of lithium disilicate ceramic. Methods: 220 ceramic discs were divided into four groups, each of which was subdivided into five subgroups (n = 11). Control group discs were immersed in one of four test beverages for 4 hours daily or in artificial saliva for 21 days. Discs in the experimental groups were continuously immersed in 0.05% NaF, 0.2% NaF, or 1.23% acidulated phosphate fluoride (APF) gel for 12, 73, and 48 hours, respectively, followed by immersion in one of the four test beverages or artificial saliva. Vickers microhardness, surface roughness, scanning electron microscopy (SEM) associated with energy dispersive spectroscopy, and atomic force microscopy (AFM) assessments were made. Data were analyzed by nested analysis of variance (ANOVA) and Tukey's test (alpha = 0.05). Results: Immersion in the test solutions diminished the microhardness and increased the surface roughness of the discs. The test beverages promoted a significant reduction in the Vickers microhardness in the 0.05% and 0.2% NaF groups. The highest surface roughness results were observed in the 0.2% NaF and 1.23% APF groups, with similar findings by SEM and AFM. Acidic beverages affected the surface topography of lithium disilicate ceramic. Fluoride treatments may render the ceramic surface more susceptible to the chelating effect of acidic solutions.

Effect of lithium on behavioral disinhibition induced by electrolytic lesion of the median raphe nucleus

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Surface characterization of lithium disilicate ceramic after nonthermal plasma treatment

Statement of problem. Surface transformation with nonthermal plasma may be a suitable treatment for dental ceramics, because it does not affect the physical properties of the ceramic material.Purpose. The purpose of this study was to characterize the chemical composition of lithium disilicate ceramic and evaluate the surface of this material after nonthermal plasma treatment.Material and methods. A total of 21 specimens of lithium disilicate (10 mm in diameter and 3 mm thick) were fabricated and randomly divided into 3 groups (n=7) according to surface treatment. The control group was not subjected to any treatment except surface polishing with abrasive paper. In the hydrofluoric acid group, the specimens were subjected to hydrofluoric acid gel before silane application. Specimens in the nonthermal plasma group were subjected to the nonthermal plasma treatment. The contact angle was measured to calculate surface energy. In addition, superficial roughness was measured and was examined with scanning electron microscopy, and the chemical composition was characterized with energy-dispersive spectroscopy analysis. The results were analyzed with ANOVA and the Tukey honestly significant difference test (alpha=.05).Results. The water contact angle was decreased to 0 degrees after nonthermal plasma treatment. No significant difference in surface roughness was observed between the control and nonthermal plasma groups. Scanning electron microscopy and energy-dispersive spectroscopy images indicated higher amounts of oxygen (O) and silicon (Si) and a considerable reduction in carbon (C) in the specimens after nonthermal plasma treatment.Conclusions. Nonthermal plasma treatment can transform the characteristics of a ceramic surface without affecting its surface roughness. A reduction in C levels and an increase in 0 and Si levels were observed with the energy-dispersive spectroscopy analysis, indicating that the deposition of the thin silica film was efficient.

Thermal analysis of coordination compounds. Part 1. Thermodecomposition of nickel(II) triphenylphosphine complexes with halides, nitrate, and thiocyanate

The compounds [NiX 2(PPh 3) 2] (where X is Cl -, Br -, I -, NO - 3, NCS -; and PPh 3 is triphenylphosphine) were prepared and characterized by infrared and atomic absorption spectroscopies and by carbon and hydrogen analyses. Simultaneous thermogravimetric (TG) and derivative thermogravimetric (DTG) curves of these complexes were recorded in air. The decrease in mass observed indicates conversion of the complexes to oxides. The thermal decomposition of the halogen and nitrate complexes occurred in a number of steps; the thiocyanate complex decomposed in a single step. © 1994.

Studies on double selenates. XI. Thermal decomposition of lanthanides of the ceric group and lithium double selenates

A previous communication [1] described the preparation of the double selenates of lanthanum and the alkali metals; the La-Li compound has the formula La2(SeO4)3 · Li2SeO4 · 8H2O. Subsequent reports [2-4] have shown that it was not possible to prepare the Ce-Li, Pr-Li, Nd-Li and Sm-Li double selenates, using the same method [1]. It was possible to isolate the double selenates of all the cerie group lanthanides and lithium not previously described and, also, a La-Li double selenate having a different stoichiometry, using a modified preparation technique. © 1990.

Lithium intercalation into double rare earth chromates

Lithium intercalation into double rare earth chromates was carried out. It was found that the compounds NaxLi1-xLa(CrO4)2 belong to the NaLa(CrO4)2 structural type and may be recommended as fast ionic conductors. At small values of x a third polymorphous modification of LiLa(CrO4)2 can be stabilized. Attempts to intercalate lithium into CsLa(CrO4)2 lead to collapse of the lamellar network with the formation of LaCrO4 and alkaline chromates. Ion exchange Li+/H+ data are consistent with these considerations. © 1994.

Hydroalumination of Thioacetylenes: A Versatile Generation and Reactions of -Aluminate Sulfides Intermediates

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Hydroalumination of seleno acetylenes: a versatile generation and reactions of alpha-aluminate vinyl selenide intermediates in the highly regio and stereoselective synthesis of telluro(seleno)ketene acetals

The hydroalumination of butylseleno acetylenes with DIBAL-H followed by addition of n-butyllithium generated in situ the (Z)-butylseleno vinyl alanates intermediates which were captured with C(4)H(9)TeBr furnishing the (E)-telluro(seleno)ketene acetals exclusively. The isomers with opposite stereochemistry (Z)-telluro(seleno)ketene acetals were obtained by the reduction of phenylseleno acetylenes with lithium di-(isobutyl)-n-butyl aluminate hydride (Zweifel's reagent) followed by reaction of (E)-phenylseleno vinyl alanates intermediates with C(4)H(9)TeBr. (c) 2008 Elsevier Ltd. All rights reserved.

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Structural and electrochemical properties of LiCoO2 prepared by combustion synthesis

LiCoO2 powders were prepared by combustion synthesis, using metallic nitrates as the oxidant and metal sources and urea as fuel. A small amount of the LiCoO2 phase was obtained directly from the combustion reaction, however, a heat treatment was necessary for the phase crystallization. The heat treatment was performed at the temperature range from 400 up to 700 degreesC for 12 h. The powders were characterized by X-ray diffraction (XRD), X ray photoelectron spectroscopy (XPS), scanning electron microscopy (SEM) and specific surface area values were obtained by BET isotherms. Composite electrodes were prepared using a mixture of LiCoO2, carbon black and poly(vinylidene fluoride) (PVDF) in the 85:10:5% w/w ratio. The electrochemical behavior of these composites was evaluated in ethylene carbonate/dimethylcarbonate solution, using lithium perchlorate as supporting electrolyte. Cyclic voltammograms showed one reversible redox process at 4.0/3.85 V and one irreversible redox process at 3.3 V for the LiCoO2 obtained after a post-heat treatment at 400 and 500 degreesC.Raman spectroscopy showed the possible presence of LiCoO2 with cubic structure for the material obtained at 400 and 500 degreesC. This result is in agreement with X-ray data with structural refinement for the LiCoO2 powders obtained at different temperatures using the Rietveld method. Data from this method showed the coexistence of cubic LiCoO2 (spinel) and rhombohedral (layered) structures when LiCoO2 was obtained at lower temperatures (400 and 500 degreesC). The single rhombohedral structure for LiCoO2 was obtained after post-heat treatment at 600 degreesC. The maximum energy capacity in the first discharge was 136 mA g(-1) for the composite electrode based on LiCoO2 obtained after heat treatment at 700 degreesC. (C) 2002 Elsevier B.V. B.V. All rights reserved.

3,5-Dimethyl-1-thiocarbamoylpyrazole and its Pd(II) complexes: Synthesis, spectral studies and antitumor activity

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Heterodyne Interferometry Applied to the Characterization of Acousto-Electro-Optic Light Modulators

When the electro-optic and acousto-optic effects are combined into a single device, the resulting acousto-electro-optic (AEO) modulator shows improved flexibility to overcome some limitations of the individual modulators or their cascade combinations. By using optical interferometry, it is possible to investigate the AEO modulator behavior as a function of this applied voltage. By this way, a lithium niobate AEO modulator is positioned in one of the arms of a Mach-Zehnder interferometer and operates at 62 MHz frequency, which constitutes the intermediate frequency of the heterodyne interferometer. Operating the AEO modulator in the acousto-optic small diffraction efficiency regime, the photodetected signal amplitude and phase are analyzed, and the induced phase shift, transmission curve and linearity response are obtained. The experimental results show good agreement with that expected from the coupled-mode theory. The possibility of linear control of the optical phase shift by the external voltage, from 0 to 2 p radians, is demonstrated.