301 resultados para Corante fluorescente


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Pós-graduação em Química - IQ

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Pós-graduação em Química - IQ

Relevância:

20.00% 20.00%

Publicador:

Resumo:

O objetivo deste trabalho foi avaliar o pH e a densidade óptica das soluções de azul de metileno a 1% e 2% (tamponadas e não tamponadas) após a imersão de três cimentos endodônticos. Foram preparados oitenta espécimes de cada cimento endodôntico (Endofill, AH Plus e Sealapex), os quais foram imersos nas soluções corantes. As soluções foram analisadas antes e após a imersão dos materiais nos períodos de tempo de 0, 24, 48 e 72h. Foram realizadas avaliações do pH utilizando um pHmetro e da densidade óptica utilizando um espectofotômetro ajustado em 596nm. Os dados de pH foram analisados através de estatística descritiva e os dados da densidade óptica foram analisados pela ANOVA e teste de Tukey 5%. Pôde-se verificar que as soluções corantes de azul de metileno tamponadas e não tamponadas apresentaram pequena variação nos valores de pH e densidade óptica antes do contato com os cimentos endodônticos. As soluções corantes não tamponadas apresentaram valores de pH menores que as tamponadas, independentemente do contato com qualquer cimento endodôntico. Os cimentos endodônticos promoveram alterações nos valores de pH das soluções corantes, sendo que as maiores alterações ocorreram nas soluções não tamponadas. Ocorreram alterações nos valores da densidade óptica das soluções corantes tamponadas e não tamponadas nos diferentes períodos de tempo de análise, sendo diferentes para cada cimento endodôntico utilizado

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The industrial development has created many environmental problems that can be observed through the changes in air, soil and water. The pollution of water bodies with compounds present in textile effluents cause beyond the visual pollution, changes in biological cycles, mainly by changing the process of photosynthesis. Due to these environmental implications it is necessary a treatment of livestock manure. The process of adsorption of the dye is a technique that has been successfully employed for effective removal of the color of the effluent. The purpose of this study was to investigate the application of a polyurethane foam plant of castor oil as an alternative adsorbent for removal of dyes in textile effluents. The study was conducted with the dye “luganil azul”, as adsorbent and the foam in a flexible manner and sprayed. It also investigated the influence of pH on the adsorption dye. The kinetic data were obtained, noting that the pH influence on adsorption. Adsorption isotherms of the dye in aqueous solution using the foam in a flexible manner also were determined experimentally.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Métodos comparativos foram desenvolvidos para detectar e quantificar o corante solvente azul 14 (SA-14) em amostras de combustíveis. O método eletroanalítico foi baseado na técnica de voltametria de onda quadrada (VOQ) com detecção em +0,60 V vs. Ag/AgCl sobre o eletrodo de carbono vítreo, usando tampão Britton-Robinson e N, N-dimetilformamida (1:1, v/v) como eletrólito suporte. Para metodologia, envolvendo a cromatografia líquida de alta performance (CLAE) foi empregada uma fase móvel composta de acetonitrila e cloreto de lítio (85:15, v/v) e a detecção eletroquímica foi realizada em um potencial de oxidação em +0,65 V vs. Ag/AgCl. Sob as melhores condições de trabalho curvas de calibração foram obtidas, para ambos os métodos, as quais foram lineares na faixa de concentração de 5,0×10 -7 a 6,0×10 -6 mol L-1 (VOQ) e 8,0×10 -8 a 3,0×10 -6 mol L-1 (CLAE). Os métodos foram aplicados para quantificar o corante em amostras de álcool e querosene após um simples processo de extração em fase sólida com resultados de recuperação satisfatórios.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The purpose of this study was to use a fluorescent dye and CLSM microscope to observe the effect of different light intensities on dentin tensile bond strength. Flat dentin surfaces were created on 16 intact human third molars and divided in 4 groups: Group G1 - halogen - KM -200R®; Group G2 - LED - Ultraled®; Group G3 - LED - UltraLume LED5® and Group G4 - LED - Biolux Single V®. For all the groups, the restoration procedure used Single Bond® adhesive, mixed with rodamin B and InTen-S® composite resin. Then, they were cut on serial sections to obtain 1 mm2 area and submitted to micro tensile test and after words, the fractures were analyzed with a digital microscope and CLSM. The statistical analysis showed that all in all groups, except Group G2, which had a significant smaller tensile bond strength ratio. The fracture mode analysis showed that there were significant differences when comparing groups G1 / G2, and G2 / G4. There is no evidence of relevant differences among the other groups. With these results, we conclude that the use of fluorescent dye and CLSM demonstrated to be a simple and nondestructive technique, and that there are evidences that light intensities influenced the dentine tensile.