580 resultados para Ferreira de Castro


Relevância:

20.00% 20.00%

Publicador:

Resumo:

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This paper is the result of a research project on the subject of youth, violence and school. The purpose of this project was to investigate the understanding of the young people on the violence in society, at school and in their own lives. The assumption is that knowing the aggressors' and victims' perspective about their experiences of violence helps to clarify the symbolic and the normative universes that rule violent conducts and the possible ways to reduce the incidence of violence. Data were collected through focus groups. One of the groups was composed by students qualified by their school's board as protagonists in situations of violence. The other group was consisted by those considered as good students. Data analysis shows the differences between the logic of violence at school, the school violence and violence against the school.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We studied the molecular epidemiology of Staphylococcus aureus strains potentially toxigenic, isolated from the production process of Minas frescal cheese in a small dairy plant in the state of São Paulo. For this, samples were taken during the period from June 2008 to July 2009. Samples were collected from the surface of the receiving and storage tanks of raw milk, the surface of the balance tank of pasteurized milk, the water supply system, the pipes and equipments, the hands of the handler and from the packaged cheese, totaling 140 samples. The colonies isolated on Baird-Parker Agar confirmed as Gram positive and positive for catalase, coagulase and acetoin production, were submitted to extraction of bacterial DNA using the Invitek - Uniscience® kit. Confirmation of the isolated species and enterotoxins SEA, SEB, SEC, SED and TSST-1 toxin was carried out through the amplification of specific fragments of chromosomal DNA. Among the 74 strains of isolated coagulase-positive staphylococci, only 41 (55.4%) strains were confirmed as Staphylococcus aureus, of which 25 (61.0%) were positive to the presence of staphylococcal toxins. The most frequently identified enterotoxin was SEA. The toxigenic strains of Staphylococcus aureus were more frequently isolated from hands of the handler (16.0%), raw milk receiving tank (12.0%), pasteurized milk for cheese making (12.0%) and fresh white cheese ready for consumption (12.0%).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Esta coletânea reúne textos resultantes de reflexões e pesquisas de professores de Universidades de diferentes países da America Latina tais como Brasil, Argentina e Uruguai e de países da Europa como França, Inglaterra e Espanha. Os textos procuram fazer uma reflexão a respeito da relação jovem violência e sociedade. Deste modo os textos tratam da violência como constituinte do ser humano relacionando-a à globalização e a outros processos sociais. São textos de pesquisadores brasileiros, de outros paises da América Latina e da Europa que se debruçam sobre a questão de jovens e violência, abordando aspectos como: internação de jovens em casas correcionais como uma das respostas da sociedade para o enfrentamento da violência juvenil; as diferentes formas e dimensões da violência como a violência de gênero, relações interpessoais nas instituições; a relação com o outro e a demarcação das diferenças e o imaginário presente no âmbito escolar e social

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A measurement is presented of the ZZ production cross section in the ZZ -> 2l2l' decay mode with l = e, mu and l' = e, mu, tau in proton-proton collisions at root s = 7 TeV with the CMS experiment at the LHC. Results are based on data corresponding to an integrated luminosity of 5.0 fb(-1). The measured cross section sigma(pp -> ZZ) = 6.24(-080)(+0.86) (stat.)(-0.32)(+0.41) (syst.) +/- 0.14 (lumi.) pb is consistent with the standard model predictions. The following limits on ZZZ and ZZ-gamma anomalous trilinear gauge couplings are set at 95% confidence level: -0.011 < f(4)(Z) < 0.012, -0.012 < f(5)(Z) < 0.012, -0.013 < f(4)(gamma) < 0.015, and -0.014 < f(5)(gamma) < 0.014.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)