Antioxidant activity and determination of total phenol contents, carotenoids, beta-carotene, lycopene and zinc in white, yellow and pinkish varieties of manihot esculenta crantz

There are cassava varieties that present compounds as carotenoids, beta-carotene, lycopene and minerals important for human and animal health. The present study evaluated the antioxidant activity of the white, yellow and pinkish varieties of Manihot esculenta, by mean of the DPPH test and by the ferrous ion-chelating activity. Furthermore, the total phenols, carotenoids, beta-carotene, lycopene and zinc contents were also determined. Utilizing the DPPH test it was possible to find that extracts of boiled samples presented higher antioxidant activity (89.53% -pinkish) in comparison to the fresh samples (1.97% -white). For the ferrous ion-chelating test, the highest activity was found for the boiled pinkish variety extract (63.43%) and the lowest was for fresh yellow extract (17.34%) the white sample did not present activity. The highest concentration of total phenols and zinc content was obtained for the boiled pinkish variety extract 136.12 mg EAG/g of extract and 0,811ppm, respectively, in the concentration of 1000 mu g/mL. The pinkish variety presented also higher quantity of pigments, including carotenoid (29.40 mu g/g), beta-carotene (9.14 mu g/100g) and lycopene (68.92%). According to the results obtained in this study it was possible to conclude that the yellow and pinkish varieties of M. esculenta present quantity of phenolic compounds and minerals sufficient to attribute the antioxidant activity and may thus contribute to reduce oxidative damage and be used as nutraceuticals or directly ingested in the diet to maintain good health.

Differences in the hydroxylation pattern of flavonoids alter their chemoprotective effect against direct- and indirect-acting mutagens

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Genotoxic effect of phenol on the cells of onion (Allium cepa ) roots

The roots of onion (Allium cepa ) stand out for having cells with large size and small number of chromosomes. These characteristics make them useful in bioassays for the measurement of a variety of cytogenetic and morphological parameters, in which they can be used as toxicity indicators of the induction and formation of micronuclei and chromosomal aberrations. Based on this background, the potential genotoxic effect of phenol concentration on cells of A. cepa roots was investigated either in terms of induced aberrations or micronuclei formation. The results demonstrated that the higher the concentration of phenol, the higher the incidence of abnormalities, thus confirming the genotoxicity of this pollutant.

Phenol oxidation by mushroom waste extracts: a kinetic and thermodynamic study

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Evaluation of pure and Ag-doped TiO2 films in the photocatalytic activity of phenol

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Comparison of DNA-extraction methods and Selective Enrichment broths on the detection of Salmonella Typhimurium in swine feces by polymerase chain reaction (PCR)

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Efeito do silício na preferência para oviposição de Bemisia tabaci biótipo B (Genn.) (Hemiptera: Aleyrodidae) em plantas de feijão (Phaseolus vulgaris L.)

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

DNA extraction from hair shafts of wild Brazilian felids and canids

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Biomimetic biosensor based on lipidic layers containing tyrosinase and lutetium bisphthalocyanine for the detection of antioxidants

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Anti-Helicobacter pylori activity and immunostimulatory effect of extracts from Byrsonima crassa Nied. (Malpighiaceae)

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Searching for gallium bioactive compounds: Gallium(III) complexes of tridentate salicylaldehyde semicarbazone derivatives

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Improved laboratory safety by decontamination of unstained sputum smears for acid-fast microscopy

Tubercle bacilli may survive in unstained heat-fixed sputum smears and may be an infection risk to laboratory staff. We compared the effectiveness of 1% and 5% sodium hypochlorite, 5% phenol, 2% glutaraldehyde, and 3.7% formalin in killing Mycobacterium tuberculosis present in smears prepared from 51 sputum samples. The smears were decontaminated by the tube and slide techniques. Phenol at 5%, glutaraldehyde at 2%, and buffered formalin at 3.7% for 1 min (tube technique) or for 10 min (slide technique) were effective in decontaminating sputum smears and preserved cell morphology and quantitative acid-fast microscopy results.

Cytotoxicity of chlorhexidine digluconate to murine macrophages and its effect on hydrogen peroxide and nitric oxide induction

Chlorhexidine, even at low concentrations, is toxic for a variety of eukaryotic cells; however, its effects on host immune cells are not well known. We evaluated in vitro chlorhexidine-induced cytotoxicity and its effects on reactive oxygen/nitrogen intermediate induction by murine peritoneal macrophages. Thioglycollate-induced cells were obtained from Swiss mice by peritoneal lavage with 5 ml of 10 mM phosphate-buffered saline, washed twice and resuspended (10(6) cells/ml) in appropriate medium for each test. Cell preparations contained more than 95% macrophages. The cytotoxicity was determined by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide assay and the presence of hydrogen peroxide (H2O2) and nitric oxide (NO) by the horseradish peroxidase-dependent oxidation of phenol red and Griess reaction, respectively. The midpoint cytotoxicity values for 1- and 24-h exposures were 61.12 ± 2.46 and 21.22 ± 2.44 µg/ml, respectively. Chlorhexidine did not induce synthesis or liberation of reactive oxygen/nitrogen intermediates. When macrophages were treated with various sub-toxic doses for 1 h (1, 5, 10, and 20 µg/ml) and 24 h (0.5, 1, and 5 µg/ml) and stimulated with 200 nM phorbol myristate acetate (PMA) solution, the H2O2 production was not altered; however, the NO production induced by 10 µg/ml lipopolysaccharide (LPS) solution varied from 14.47 ± 1.46 to 22.35 ± 1.94 µmol/l and 13.50 ± 1.42 to 20.44 ± 1.40 µmol/l (N = 5). The results showed that chlorhexidine has no immunostimulating activity and sub-toxic concentrations did not affect the response of macrophages to the soluble stimulus PMA but can interfere with the receptor-dependent stimulus LPS.

Extração de DNA de materiais de arquivo e fontes escassas para utilização em reação de polimerização em cadeia (PCR)

Este trabalho visou a comparação de cinco métodos diferentes de extração de DNA de materiais de arquivo (tecidos incluídos em parafina, esfregaços de sangue periférico - corados e não corados com Leishman, lâminas com mielogramas, gotas de sangue em Guthrie Card) e de fontes escassas (células bucais, um e três bulbos capilares e 2 mL de urina), para que fossem avaliadas a facilidade de aplicação e a facilidade de amplificação deste DNA pela técnica da reação de polimerização em cadeia (PCR). Os métodos incluíram digestão por proteinase K, seguida ou não por purificação com fenol/clorofórmio; Chelex 100® (BioRad); Insta Gene® (BioRad) e fervura em água estéril. O DNA obtido foi testado para amplificação de três fragmentos gênicos: Brain-derived neutrophic factor (764 pb), Factor V Leiden (220 pb) e Abelson (106 pb). de acordo com o comprimento do fragmento gênico estudado, da fonte potencial de DNA e do método de extração utilizado, os resultados caracterizaram o melhor caminho para padronização de procedimentos técnicos a serem incluídos no manual de Procedimentos Operacionais Padrão do Laboratório de Biologia Molecular do Hemocentro - HC - Unesp - Botucatu.