Velocidade do fluxo de ar em barra de pulverização no controle químico de Anticarsia gemmatalis, Hübner e percevejos na cultura da soja

A lagarta Anticarsia gemmatalis (Hübner) e os percevejos fitófagos são pragas importantes na cultura da soja no Brasil. Este trabalho objetivou avaliar o controle desses insetos após o tratamento com inseticidas, sob diferentes velocidades do fluxo de ar junto à barra de pulverização nessa cultura. O experimento foi desenvolvido em Botucatu, na cultura da soja [Glycine max (L.) Merrill], var. Conquista (safra 2007/08), no delineamento experimental de blocos ao acaso (quatro velocidades do fluxo de ar: 0, 9, 11 e 29 km h-1), mais testemunha, totalizando cinco tratamentos e quatro repetições. No estádio de desenvolvimento vegetativo (V10) realizou uma aplicação do inseticida deltametrina na dosagem de 6,5 g do i.a. ha-1 para o controle de lagartas e no estádio de desenvolvimento reprodutivo (R6) aplicou o inseticida tiametoxam associado com lambda-cialotrina na dosagem de 25,38 + 19,08 g do i.a. ha-1 para o controle de percevejos. A aplicação foi feita com um pulverizador Advanced Vortex 2000, com pontas de pulverização jato cônico JA2, conferindo um volume de calda de 200 L ha-1. As avaliações antes e após a aplicação foram realizadas pelo método de batidas no pano. Avaliaram-se os danos causados por percevejos, considerando-se a porcentagem de danos às sementes, ao poder germinativo e à produtividade. No geral, o número médio de lagartas e percevejos foram significativamente menores nas parcelas tratadas em relação ao obtido na testemunha. Não houve diferença de produtividade entre os tratamentos. A porcentagem de emergência e sementes picadas por percevejos foram significativamente menores nos tratamentos que receberam o controle em comparação à testemunha.

Superação da dormência de sementes de capim-carrapicho

O objetivo desta pesquisa foi o de identificar tratamentos que, capazes de superar a dormência das sementes de Cenchrus echinatus, fossem favorá veis à germinação e passíveis de serem aplicados visando semeadura à campo. Para tanto, 4 lotes de sementes foram submetidos a tratamentos de escarificação mecânica, de retirada do invólucro de brácteas espinhosas e das glumas para a separa ção da cariopse , de imer são em KNO3 (1%) por 5 e 20 minuto s, imer sã o em KNO3 (1, 3 e 5%) por 5 minutos, de imersão em H2O por 5 minutos, de armazenamento a 5°C/ 7 dias, de exposição à 40, 55 e 70°C/ 8h em estufa com circulação forçada de ar e de imersão em H2SO4 (98%, 36N) por 1; 5 e 15 minutos seguida por lavagem em água co rren te. As sementes tratadas foram avaliadas por meio dos testes de germinação e de emergência de plântulas; de primeira contagem de germinação e de emergência de plântulas, de velocidade germinação e de emergência. Os tratamentos de escarificação mecânic a, da cariopse nua e de imersão das sementes em KNO3 (1 a 3%) por 5 minutos são técnicas de superação da dormência capazes de implementar a emergência em condições de campo.

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Velocidade de hidratação em função de características do tegumento de sementes de soja de diferentes cultivares e localidades

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Duração do teste de germinação do capim-tanzânia

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Maturação e secagem de sementes de Peltophorum dubium (Spreng.) Taubert (CANAFÍSTULA)

O trabalho foi desenvolvido em Botucatu, SP, e teve por objetivo determinar o momento de ocorrência do máximo potencial de germinação durante a maturação das sementes de canafístula, relacionando-a com a secagem dos frutos. Cinco árvores, em final de floração, tiveram 15 inflorescências etiquetadas em 06/02/ 2002. As colheitas, realizadas semanalmente, foram iniciadas na quinta semana após a etiquetagem (35 DAE) e finalizaram quando ocorreu o início da dispersão dos frutos (98 DAE), totalizando 10 colheitas. Os frutos das cinco plantas foram colhidos e avaliados separadamente. em cada colheita, os frutos foram divididos em duas porções: uma teve as sementes extraídas (sementes frescas), e a outra foi posta para secar em ambiente natural de laboratório para, então, se extraírem as sementes (sementes secas). Determinaram-se o teor de água e a massa seca de 100 sementes frescas e 100 secas. Os testes de germinação das sementes, frescas e secas, foram realizados com e sem escarificação. O delineamento experimental utilizado foi o de blocos casualizados, considerando-se a árvore e o bloco. A maior capacidade germinativa das sementes foi atingida após a ocorrência do máximo acúmulo de massa. O máximo potencial de germinação, detectado nas sementes escarificadas, foi observado no início da dispersão, quando predominavam sementes duras. A maturação, a germinação e a instalação da dormência em semente imatura foram antecipadas com a sua secagem no interior do fruto separado da planta-mãe.

Reguladores de crescimento e seus efeitos sobre a qualidade fisiológica de sementes e crescimento de plântulas de crotalária

Information regarding the use of growth regulators in sunn hemp is still scarce, especially on the physiologic quality of seeds and growth seedlings. In this aspect, product knowledge and application rate stands out as relevant factors in production of quality seeds. This work aimed to evaluated the effect of the foliar application of growth regulators (mepiquat chloride, etil-trinexapac and paclobutrazol) in different rates (0; 75; 150; 225 and 300 g ha(-1)), on the physiological quality of seeds and growth seedlings of Crotalaria juncea cultivated in no-tillage system. The treatments were disposed in randomized complete block design in factorial scheme 3 x 5 (regulators x rates of application), with four replications. The results were submitted to the variance analysis, with the growth regulators compared by Tukey test and the rates for polynomial regression. Not if recommended the application of mepiquat chloride in sunn hemp culture by reducing the potential of seeds germination and dry biomass of seedlings. The etil-trinexapac must be applied in rate of 300 g ha(-1), based on the reduction of moisture content and the electrical conductivity of seeds, the greater total length of seedlings and dry biomass of seedlings. The paclobutrazol must be applied in rate of 75 g ha(-1), considering the potential and speed of seeds germination.

Genetic diversity of three size classes of seeds of Eucalyptus globulus ssp. globulus

Variation in seed size is often observed in samples of eucalypt seeds and this leads to heterogeneous populations of plants, principally through variation in the early stages of plant development. It follows that samples of seeds more uniform in size could produce more uniform populations of plants. In studies of Eucalyptus globulus ssp. globulus it was of interest to determine whether or not the genetic diversity within a population, through the use of isozyme markers, was altered in the subpopulations developed from seeds of different size classes. A commercial sample of seed was separated by seed size into three subpopulations and the percentage germination and mean fresh weight of the seedlings were determined. Proteins extracted from leaves of the seedlings were separated by electrophoresis and tested for activity of eight different enzymes. These eight enzymes showed activity at 20 loci and mean genetic diversity and fixation index were determined using 13 of these loci. The subpopulation of the smallest seeds contained a greater proportion of abnormal seeds and had a lower percentage germination and plant weight compared to the other subpopulations. No significant differences were found in the number of alleles per locus, percentage of polymorphic loci, mean heterozygosity. The major part of the endogamy, indicated by F statistic, was found within the subpopulations: F-(IS) = 0.518; F-(ST) = 0.010 and F(IT) = 0.523. We conclude that the use of seeds of uniform size will lead to more uniform germination and plant growth without alteration in overall genetic diversity.

Influência de diferentes níveis de cálcio em plantas de estilosantes (Stylosanthes guyanensis (Aubl.) Sw. cv. Cook), avaliados através de alguns parâmetros fisiológicos

O objetivo do presente trabalho foi estudar os efeitos de diferentes níveis de cálcio, no desenvolvimento de plantas de Stylosanthes guyanensis (Aubl.) Sw. cv. Cook, através de alguns parâmetros que compõem a análise fisiológica de crescimento. Para tal foram empregados 4 tratamentos a saber: T1 (200 mg de cálcio/litro); T2 (133,33 mg de cálcio/litro); T3 (66,66 mg de cálcio/litro) e T4 (omisso em cálcio). O trabalho foi montado em cultivo hidropônico, utilizando-se a solução nutritiva n° 1 de Hoagland & Arnon e conduzido em casa de vegetação. Foram realizadas observações em intervalos entre 5 coletas, distribuidas da seguinte maneira: intervalo I (entre 24° e 38° dia pós-germinação; intervalo II ( do 38° ao 52° dia); intervalo III (do 52° ao 66° dia) e intervalo IV (do 66° ao 80° dia). Os parâmetros estudados foram: a. taxa assimilatória líquida (TAL); b. taxa de crescimento relativo (TCR) e c. razão alfa. Dos resultados obtidos pode-se concluir que soluções com 200 e 133,33 mg de cálcio/litro, foram mais eficientes em promover o desenvolvimento de plantas de estilosantes.

Fotoperíodo, temperatura e reguladores vegetais na germinação de sementes de Passiflora cincinnata Mast.

A espécie Passiflora cincinnata Mast., pertencente à família Passifloraceae, é silvestre e popularmente conhecida como maracujá-do-mato, sendo considerada importante na produção de porta-enxertos, uma vez que é tolerante à seca, a doenças causadas por bactérias e a nematóides, além de poder ser utilizada em programas de melhoramento genético. O trabalho teve como objetivos estudar o efeito da luz e da temperatura e a interação entre temperatura e reguladores vegetais na germinação de sementes de Passiflora cincinnata Mast. Foi constituído de três experimentos: no primeiro, estudou-se o efeito da luz e da temperatura na germinação de sementes; no segundo, o efeito de diferentes concentrações dos reguladores vegetais GA4+7 + N-(fenilmetil)-aminopurina na germinação das sementes e, no terceiro, a interação entre temperatura e reguladores vegetais na germinação das sementes. O delineamento experimental foi inteiramente casualizado para todos os experimentos e os dados foram submetidos à análise de variância e comparação das médias pelo teste Tukey, a 5% de probabilidade. É possível observar que a luz exerce efeito inibitório sobre a germinação das sementes, e que os reguladores vegetais, GA4+7 + N-(fenilmetil)-aminopurina, são eficientes na superação da dormência, além de ampliarem os limites de temperatura da germinação. A temperatura alternada 20-30ºC mostra-se a mais adequada para a germinação de sementes dessa espécie.

Métodos de superação da dormência e temperatura na germinação de sementes de dioclea violácea

The aim of this experiment was to overcome the dormancy and the effect of different temperatures in Dioclea violacea seeds' germination. Two experiments were developed. In the first, it was studied the use of chemical and mechanical scarification in the overcome dormancy seeds. Therefore, were accomplished seven treatments with four replications of 15 seeds each. The experiment constituted of one testify treatment, five chemical scarification treatments (1, 2, 3, 4 and 5 hours of immersion in concentrated sulfuric acid - H(2)SO(4)) and one mechanical scarification treatment. In the second experiment, was studied the temperature effects on germination seeds; it was constituted on six treatments with four replications with 12 seeds each. The treatments constituted of constant temperatures 15 degrees C, 20 degrees C, 25 degrees C, 30 degrees C and 35 degrees C and the alternate temperature 20-30 degrees C ( 16 and 8 hours, respectively). Germination, died seeds, hard seeds percentages, medium time germination and germination speed index were determined. The data were submitted to the variance analysis, and the averages compared by the Tukey test to 5% of probability and regression analysis. It was observed that the dormancy overcome of Dioclea violacea seeds can be done with chemical scarification, 3 to 5 hours in H(2)SO(4), as much as with mechanical scarification. Also, it was possible to conclude that Dioclea violacea seeds germinate in a wide temperature strip, with constant temperatures of 20 degrees C, 25 degrees C and 35 degrees C benefit the germination process.

In vitro allelopathic potential of Leonurus sibiricus L. leaves

The chemical interaction between plants is known as allelopathy and it is related to the release of substances into the environment. The present study aimed at the evaluation of the allelopathic activity of the leaves of Leonurus sibiricus against the germination and initial growth of Raphanus sativus, Lactuca sativa, and Lepidium sativum. Chemical analyses showed the presence in the leaves of four major flavonoids (quercetin-3-O-alpha-L-rhamnopyranosyl-(1 > 6)-beta-D-galactopyranoside; rutin; hyperin, and isoquercetrin) and of three minor flavonoidic compounds (genkwanin, 3'-hydroxy genkwanin, and quercetin). Extracts, their chromatographic fractions and pure isolated flavonoids showed different biological activities. A methanol extract of leaves of Leonurus sibiricus caused significant reduction only in the germination of Lactuca sativa, with no effects on the germinative processes of Raphanus sativus and Lepidium sativum. Some chromatographic fractions, containing the flavonoids, showed inhibitory activity on the initial stages of root growth of all tested seeds. The isolated flavonoids, at the higher concentration tested (10(-4) M) seemed to be responsible for the inhibition of the germination, as well as the radical elongation. Among pure compounds, 3'-OH-genkwanin and quercetin showed the stronger antigerminative activity at the concentration of 10(-4) M, whereas the radical elongation was reduced by rutin, isoquercetrin and 3'-OH-genkwanin. All compounds, tested at concentrations ranging between 10(-5) and 10(-7) M, showed stimulatory activities.

The Antigerminative Activity of Twenty-Seven Monoterpenes

Monoterpenes, the main constituents of essential oils, are known for their many biological activities. The present work studied the potential biological activity of twenty-seven monoterpenes, including monoterpene hydrocarbons and oxygenated ones, against seed germination and subsequent primary radicle growth of Raphanus sativus L. (radish) and Lepidium sativum L. (garden cress), under laboratory conditions. The compounds, belonging to different chemical classes, showed different potency in affecting both parameters evaluated. The assayed compounds demonstrated a good inhibitory activity in a dose-dependent way. In general, radish seed is more sensitive than garden cress and its germination appeares more inhibited by alcohols; at the highest concentration tested, the more active substances were geraniol, borneol, (+/-)-beta-citronellol and alpha-terpineol. Geraniol and carvone inhibited, in a significant way, the germination of garden cress, at the highest concentration tested. Radicle elongation of two test species was inhibited mainly by alcohols and ketones. Carvone inhibited the radicle elongation of both seeds, at almost all concentrations assayed, while 1,8-cineole inhibited their radicle elongation at the lowest concentrations (10(-5) M, 10(-6) M).

Phytotoxic Activities of Mediterranean Essential Oils

Twelve essential oils from Mediterranean aromatic plants were tested for their phytotoxic activity, at different doses, against the germination and the initial radicle growth of seeds of Raphanus sativus, Lactuca sativa and Lepidium sativum. The essential oils were obtained from Hyssopus officinalis, Lavandula angustifolia, Majorana hortensis, Melissa officinalis, Ocimum basilicum, Origanum vulgare, Salvia officinalis and Thymus vulgaris (Lamiaceae), Verbena officinalis (Verbenaceae), Pimpinella anisum, Foeniculum vulgare and Carum carvi (Apiaceae). The germination and radicle growth of tested seeds were affected in different ways by the oils. Thyme, balm, vervain and caraway essential oils were more active against both germination and radicle elongation.

Períodos de estratificação na germinação de sementes de alface (Lactuca sativa L.) sob diferentes condições de luz e temperatura

Lettuce seeds have a high sensitivity to variations in humidity and temperature of the environment where they germinate, therefore, studies with the aim of improve the germination and physiological performance of these have been conducted. Thus, the study aimed to evaluate the efficiency of pre-germination treatment stratification (5 degrees C) for different periods, and increase the uniformity of germination of lettuce seeds submitted to different conditions of light and germination temperatures. In the pre-germinative treatment, the seeds of lettuce (Lactuca sativa L.) var. American Great Lakes were placed in plastic boxes dark of the type "gerbox" and subjected to temperature stratification of 5 degrees C and the dark for 0, 4, 8, 12 and 16 hours. After periods of stratification the seeds were submitted to germination tests which were transferred to plastic boxes type "gerbox" transparent (constant light) and dark (no light) and were maintained in a germination chamber B.O.D with light constant at temperatures of 20, 25, 30 and 35 degrees C. The design used was the entirely randomized with four repetitions, in a factorial outline 5x4x2, five pre-germinative treatments, four germination temperatures and two light conditions. Stratification for 16 hours and temperatures of 20 and 25 degrees C stimulated the germination of lettuce seeds, providing a higher germination percentage, germination speed index and minor mean germination time. The presence of light resulted in increased germination at 0, 4, 8 and 12 hours of stratification.