Efeitos da sexagem por citometria de fluxo sobre a composição protéica da membrana de espermatozóides bovinos

Pós-graduação em Medicina Veterinária - FMVZ

Indução a espermiação do mandi-pintado, Pimelodus britskii no período reprodutivo (Teleostei: Pimelodidae)

Pós-graduação em Aquicultura - FCAV

Parâmetros seminais, ultraestruturais, criopreservação e androgênese de espécies do gênero Brycon ameaçadas de extinção

Pós-graduação em Aquicultura - FCAV

The seasonal and ovarian status effects on in vitro production of domestic cat embryos between Equator and Tropic of Capricorn

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

PCR fluorescente associada à eletroforese capilar como ferramenta de diagnóstico de bactérias no semen

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.

In vitro trypanocidal activity of solamargine and extracts from Solanum palinacanthum and Solanum lycocarpum of brazilian cerrado

O objetivo deste estudo foi avaliar a potencial atividade tripanocida do extrato bruto etanólico dos frutos de Solanum palinacanthum, Solanum lycocarpum e do glicoalcalóide solamargina. Pó do fruto seco de S. palinacanthum e S. lycocarpum foram submetidos a extracção por refluxo com etanol a 96% e solamargina foi isolada a partir do extrato bruto de S. palinacanthum. Foram determinadas de ambos os extratos e a solamargina a atividade tripanocida utilizando o ensaio colorimétrico MTT. O Extrato de S. palinacanthum mostrou-se mais ativo (IC50 = 175,9 µg.ml–1) de que o extrato de S. lycocarpum (IC50 = 194,7 µg.ml–1). A solamargina apresentou forte atividade tripanocida (IC50 = 15,3 µg.ml–1), o que pode explicar a melhor atividade de ambos os extratos. O benzonidazol (IC50 = 9,0 µg.ml–1) é a única droga utilizada para o tratamento da doença de Chagas. Estes resultados demonstram pela primeira vez que os extratos etanólicos obtidos a partir de frutos de S. palinacanthum e S. lycocarpum, além da solamargina apresentam uma atividade tripanocida potencial.

Aspectos reprodutivos, morfologia dos gametas e desenvolvimento embrionário de Astyanax altiparanae Garutti & Britski (Teleostei, Characidae)

Pós-graduação em Aquicultura - FCAV

Embriões bovinos produzidos in vitro com espermatozoides sexados por citometria de fluxo: avaliação do desenvolvimento embrionário e da expressão de genes candidatos ao reconhecimento da gestação

Pós-graduação em Genética e Melhoramento Animal - FCAV

Capacidade de ligação dos espermatozóides de epidídimo de equinos às células da tuba uterina cultivadas in vitro

Pós-graduação em Biotecnologia Animal - FMVZ

Efeito da administração da sulpirida no desenvolvimento folicular em éguas

Pós-graduação em Biotecnologia Animal - FMVZ

Degenerative joint disease in cattle and buffaloes in the Amazon region: a retrospective study

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

As blusas verdes e as marchadeiras. Movimentos de mulheres e participação politica nos anos 30 e 60

Understanding the women’s political manifest at the present national scenario through analyzing the historicity and complexity of women’s movement and their contradictions regarding females / feminists actions in public and political areas. Thus, I give emphasis to the 30s and its “green blouses” and 60’s with “the marchadeiras” showing how those conservatives movements and their facist trend took on organized actions. And, also acting on the opposite way of democratic areas and the struggles for increasing the rights and advocating the maintenance of a status quo, keeping female traditional practices. Those women, who were living in the most visible female conjunctures and resistance to authoritarian governments, have taken positions that were holding back the progress in the game, contributing to reflux before the conquest of rights and gender equity.

Remoção da adesividade em ovos de Pseudoplatystoma fasciatum

Pós-graduação em Aquicultura - FCAV

Indução a espermiação e criopreservação espermática de Brycon cephalus (Gunther, 1869) (teleostei: characidae)

Pós-graduação em Ciência e Tecnologia Animal - FEIS

Biotecnologias aplicadas à reprodução de éguas velhas

The acceptance of biotechnology for the most equine breeders association had a significant effect in the horse industry, gaining popularity around the world, because the increasing on the genetic gain, allowing the use of sub fertile mares and stallions with high genetics value on reproduction. The embryos in vitro production of human and cattle has been used with success, however in vitro embryo production is not efficient in the horse, as oocyte transfer (OT) and intracytoplasmatic sperm injection (ICSI). The oocyte transfer has been used especially in subfertile old mares presenting reproductive pathologies as: endometrite, cervical and uterine adhesions, blocked oviduct, perineal laceration and ovulation failures. During oocyte recovery process, the oocytes must be collected from immature follicles that need be matured in vitro or in vivo matured oocytes from pre-ovulatory follicles through the transvaginal aspiration guided by ultrasound. The recovered oocyte is transferred to a previously inseminated recipient mare, through the flank laparotomy. The intracytoplasmatic sperm injection (ICSI) is a procedure of in vitro fertilization that needs only one sperm that is aspirated and injected inside the oocyte. The oocytes used, can be from mature and immature follicles. Fresh, cooled and frozen semen can be used, because the procedure not requires a functional sperm. The use of Piezo drill resulted in a breakthrough the pellucid zone, allowing the vibration per minute provided in the sperm injection pipette, a major result of cleaved oocytes, due to a better sperm injection in the oocyte. The embryo transfer can be straight inside the oviduct, as also transcervical transferred after embryo culture produced in vitro. In conclusion both procedures (OT and ICSI) are effective to be used on equine assisted reproduction, getting results even lower than expected, but satisfactory from animal genetically superior