Avaliação da presença de Toxoplasma gondii em quibes crus e em carnes suína e bovina comercializadas em Botucatu-SP

Pós-graduação em Medicina Veterinária - FMVZ

Caracterização citogenética e molecular das espécies Cichla kelberi e Cichla piquiti e seu possível híbrido interespecífico coletados em ambientes naturais

Pós-graduação em Ciências Biológicas (Zoologia) - IBB

Qualidade higiênico-sanitária e ocorrência de Aeromonas sp. e Escherichia coli em tilápias comercializadas no varejo

Pós-graduação em Aquicultura - FCAV

PCR fluorescente associada à eletroforese capilar como ferramenta de diagnóstico de bactérias no semen

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.

Allele frequency of hereditary equine regional dermal asthenia in American Quarter horses in Brazil determined by quantitative real-time PCR with high resolution melting analysis

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Dengue-4 false negative results by Panbio (R) Dengue Early ELISA assay in Brazil

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Evaluation of ERIC-PCR as Genotyping Method for Corynebacterium pseudotuberculosis Isolates

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Evaluation of hsp65 Nested PCR-Restriction Analysis (PRA) for Diagnosing Tuberculosis in a High Burden Country

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Comparison of PCR with stained slides of bone marrow and lymph nodes aspirates with suspect diagnosis for leishmaniasis

Visceral leishmaniasis (VL), also known as kala-azar, is a disseminated protozoan infection caused by Leishmania donovani complex. Traditionally the definite diagnosis is made by amastigote detection in the tissue. The aim this study was to evaluate the PCR technique in stained slides of bone marrow and lymph nodes aspirates with suspect diagnosis for leishmaniasis. Slides were selected totaling 62 suspect cases (33 bone marrow samples and 29 lymph node samples) and 17 positive cases (8 bone marrow and 9 lymph node). From 62 suspect cases, 39 (62.90%) were confirmed to be positive being 17 (n = 29) lymph node aspirates and 22 (n = 33) bone marrow. This finding is in agreement with the higher sensitivity of the PCR assay compared to direct microscopic observation. In conclusion, the findings of this study supports the use of PCR on archive cytological preparation stained slides for the diagnosis of canine visceral leishmaniasis, emphasizing the higher sensitivity of this technique when compared to direct microscopic examination and mostly the use of the suspect status for the cytology samples that presents the previously mentioned particularities with focus on detecting the oligosymptomatic or assymptomatic dogs in endemic areas functioning as potential reservoirs for this disease. (C) 2014 Elsevier B.V. All rights reserved.

The detection of Cryptosporidium serpentis in snake fecal samples by real-time PCR

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Diagnosis of gastric cryptosporidiosis in birds using a duplex real-time PCR assay

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Species-specific PCR for the identification of Cooperia curticei (Nematoda: Trichostrongylidae) in sheep

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Analysis of the intestinal bacterial microbiota in maize- or sorghum-fed broiler chickens using real-time PCR

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Perfil de virulência e resistência aos antimicrobianos em Staphylococcus haemolyticus, S. warneri, S. lugdunensis e S. hominis

Estudar o perfil patogênico e de resistência aos antimicrobianos em amostras de Staphylococcus haemolyticus, Staphylococcus warneri, Staphylococcus lugdunensis e Staphylococcus hominis. Foram estudadas 65 amostras isoladas de pacientes do Hospital das Clínicas da FMB, Botucatu, sendo 23 S. haemolyticus, 23 S. hominis, 10 S. warneri e 9 S. lugdunensis. Foram pesquisados por PCR os genes responsáveis pela produção de biofilme (icaA, icaC, icaD), genes de enterotoxinas (sea, seb, sec, sed), Toxina 1 da Síndrome do Choque Tóxico (tst) e resistência à oxacilina (mecA). Das 65 amostras estudadas, 83% apresentaram ao menos um dos genes das toxinas pesquisadas, 87,7% um dos genes ica e 63,1% o gene mecA. O SCCmec foi tipado por PCR-Multiplex, sendo o tipo I o mais prevalente (34,1%). A heterorresistência à vancomicina foi pesquisada através da triagem em ágar BHI com 4 μg ml-1, encontrada em 36,9% das amostras, e com 6 μg ml-1 de vancomicina, encontrada em 15,4%. Todas as espécies estudadas foram altamente toxigênicas. A presença do SCCmec I apresentou relação com a heterorresistência à vancomicina. Ainda, S. hominis e S. haemolyticus se revelaram mais virulentos e resistentes, levando em conta os fatores de virulência, resistência à oxacilina e heterorresistência à vancomicina. A evidência e a necessidade de maior preocupação com as espécies S. hominis e S. haemolyticus ficou clara, o que ainda não havia sido relatado, bem como a relação entre a presença de SCCmec I e heterorresistência à vancomicina