364 resultados para Ferramenta de monitoramento
Resumo:
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)
Resumo:
Pós-graduação em Ciências Biológicas (Zoologia) - IBRC
Resumo:
Pós-graduação em Ciências Biológicas (Zoologia) - IBRC
Resumo:
Pós-graduação em Engenharia Mecânica - FEIS
Resumo:
Pós-graduação em Saúde Coletiva - FMB
Resumo:
Pós-graduação em Biotecnologia - IQ
Resumo:
Pós-graduação em Fisiopatologia em Clínica Médica - FMB
Resumo:
Pós-graduação em Agronomia (Energia na Agricultura) - FCA
Resumo:
A borracha natural (BN) de três clones de seringueira [Hevea brasiliensis (Willd. exAdr. de Juss. Muell.-Arg.)] de um período de sete meses foi obtida por coagulação do látex com solução de ácido acético a 10% e seca a 65°C. As curvas TG-DTG foram utilizadas para monitorar as propriedades térmicas da BN. Os resultados indicaram pequenas variações entre clones e coletas, exceto no valor de Tf-T0, indicando que o clone IAC 301 sofre degradação mais rápida durante o processo termo degradação da BN seca. Não houve diferenças significativas nos valores de Tg entre clones e coletas.
Resumo:
Environmental monitoring of aquatic systems is an important tool to support policy makers and environmental managers' decisions. Long-term, continuous collection of environmental data is fundamental to the understanding of an aquatic system. This paper aims to present the integrated system for environmental monitoring (SIMA), a long-term temporal series system with a web-based archive for limnological and meteorological data. The following environmental parameters are measured by SIMA: chlorophyll-a (µgL-1), water surface temperature (ºC), water column temperature by a thermistor string (ºC), turbidity (NTU), pH, dissolved oxygen concentration (mg L-1), electric conductivity (µS cm-1), wind speed (ms-1) and direction (º), relative humidity (%), shortwave radiation (Wm-2) and barometric pressure (hPa). The data were collected in a preprogrammed time interval (1 hour) and were transmitted by satellite in quasi-real time for any user within 2500 km of the acquisition point. So far, 11 hydroelectric reservoirs are being monitored with the SIMA buoy. Basic statistics (mean and standard deviation) and an example of the temporal series of some parameters were displayed at a database with web access. However, sensor and satellite problems occurred due to the high data acquisition frequency. Sensors problems occurred due to the environmental characteristics of each aquatic system. Water quality sensors rapidly degrade in acidic waters, rendering the collected data invalid. Data is also rendered invalid when sensors become infested with periphyton. Problems occur with the satellites' reception of system data when satellites pass over the buoy antenna. However, the data transfer at some inland locations was not completed due to the satellite constellation position. Nevertheless, the integrated system of water quality and meteorological parameters is an important tool in understanding the aquatic system dynamic. It can also be used to create hydrodynamics models of the aquatic system to allow for the study of meteorological implications to the water body.
Resumo:
This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.
Resumo:
We studied the molecular epidemiology of Staphylococcus aureus strains potentially toxigenic, isolated from the production process of Minas frescal cheese in a small dairy plant in the state of São Paulo. For this, samples were taken during the period from June 2008 to July 2009. Samples were collected from the surface of the receiving and storage tanks of raw milk, the surface of the balance tank of pasteurized milk, the water supply system, the pipes and equipments, the hands of the handler and from the packaged cheese, totaling 140 samples. The colonies isolated on Baird-Parker Agar confirmed as Gram positive and positive for catalase, coagulase and acetoin production, were submitted to extraction of bacterial DNA using the Invitek - Uniscience® kit. Confirmation of the isolated species and enterotoxins SEA, SEB, SEC, SED and TSST-1 toxin was carried out through the amplification of specific fragments of chromosomal DNA. Among the 74 strains of isolated coagulase-positive staphylococci, only 41 (55.4%) strains were confirmed as Staphylococcus aureus, of which 25 (61.0%) were positive to the presence of staphylococcal toxins. The most frequently identified enterotoxin was SEA. The toxigenic strains of Staphylococcus aureus were more frequently isolated from hands of the handler (16.0%), raw milk receiving tank (12.0%), pasteurized milk for cheese making (12.0%) and fresh white cheese ready for consumption (12.0%).
Resumo:
Algae bloom is one of the major consequences of the eutrophication of aquatic systems, including algae capable of producing toxic substances. Among these are several species of cyanobacteria, also known as blue-green algae, that have the capacity to adapt themselves to changes in the water column. Thus, the horizontal distribution of cyanobacteria harmful algae blooms (CHABs) is essential, not only to the environment, but also for public health. The use of remote sensing techniques for mapping CHABs has been explored by means of bio-optical modeling of phycocyanin (PC), a unique inland waters cyanobacteria pigment. However, due to the small number of sensors with a spectral band of the PC absorption feature, it is difficult to develop semi-analytical models. This study evaluated the use of an empirical model to identify CHABs using TM and ETM+ sensors aboard Landsat 5 and 7 satellites. Five images were acquired for applying the model. Besides the images, data was also collected in the Guarapiranga Reservoir, in São Paulo Metropolitan Region, regarding the cyanobacteria cell count (cells/mL), which was used as an indicator of CHABs biomass. When model values were analyzed excluding calibration factors for temperate lakes, they showed a medium correlation (R²=0.81, p=0.036), while when the factors were included the model showed a high correlation (R²=0.96, p=0.003) to the cyanobacteria cell count. The empirical model analyzed proved useful as an important tool for policy makers, since it provided information regarding the horizontal distribution of CHABs which could not be acquired from traditional monitoring techniques.
Resumo:
Data from reference stations are widely used in GNSS (Global Navigation Satellite System) positioning, and can be used in relative positioning or network-based positioning concept. Positioning accuracy will be directly influenced by errors in signals collected in these stations. In this paper, it is aimed at evaluating these data quality using temporal series of multipath index MP1 and MP2. A statistical study of temporal series with 7 years of daily observations related to 7 stations from RBMC (Rede Brasileira de Monitoramento Contínuo) was accomplished. In order to investigate trends and seasonality a linear regression model, correlograms, and Fourier periodograms were used. We also used a harmonic adjust to identify peaks on temporal series. At last, the possible causes of seasonality found in some stations were discussed. It was also possible to identify peaks in MP values of March and October months (mainly in stations located near geomagnetic equator).
Resumo:
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)