213 resultados para phenol photodegradation
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)
Resumo:
Pós-graduação em Agronomia (Horticultura) - FCA
Resumo:
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)
Resumo:
Pós-graduação em Zootecnia - FMVZ
Resumo:
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)
Resumo:
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)
Resumo:
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)
Resumo:
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)
Resumo:
Pós-graduação em Medicina Veterinária - FMVZ
Resumo:
Pós-graduação em Química - IQ
Resumo:
This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.
Resumo:
Thirty nine isolates of Flavobacterium columnare from Brazilian fish farms had their carbohydrate composition of EPS evaluated by high efficiency liquid chromatography, using the phenol-sulfuric acid method of EPS. The occurrence of capsules on F. columnare cells was not directly related to biofilm formation, and the predominant monosaccharide is glucose.
Resumo:
Energy substrate used by workers of leaf-cutting ants during nest excavation. In this study we aimed to ascertain whether leaf-cutting ant workers lose body reserves (fat or sugars) as a function of nest excavation. For each treatment, we isolated 10 workers of Atta sexdens into two experimental groups, Control (C- without excavation) and Soil (S- with excavation), which were kept for different time intervals (0, 24, 48 or 72 hours), totaling 700 tested workers. We then determined the concentration of soluble carbohydrates and total lipid content in them. The total carbohydrates were determined colorimetrically, based on the reaction between carbohydrates and sulfuric acid-phenol. For determination of lipids, the insects were immersed in organic solvent until they reached a constant weight. Our results showed that carbohydrates are consumed during nest excavation activities. In the experimental groups S24, S48 and S72, there was an average reduction of 5.82 (20.42%), 14.31 (44.96%) and 13.27 (43.96%) µ.mg-1 in soluble sugar when compared with the experimental groups that did not excavate. Furthermore, the lipids were not used during this activity. With respect to dry mass of the workers, their values were C0 = 8%, C24 = 10.4%, C48 = 9.2%, C72 = 10%, S24 = 9.2%, S48 = 8.7% and S72 = 8.5%. Our results show experimentally that the source of energy for nest excavation is carbohydrates, whereas lipids are conserved for other activities.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)