152 resultados para Brucella melitensis biovar Ovis
Resumo:
This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.
Resumo:
Pós-graduação em Medicina Veterinária - FCAV
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)
Resumo:
This study evaluated the prevalence and counting parasitism of different species of helminths of sheep from the micro-region of Jaboticabal of Sao Paulo state. For this, 66 animals naturally infected, four to 36 months of age, raised in pasture, were selected. The results of necropsy revealed the presence of seven genera and 12 species with the following prevalence and mean count: Haemonchus contortus: 100.0% (2947.2); Trichostrongylus colubriformis: 90.9% (3048.8); Cooperia curticei: 56.0% (256.5); Oesophagostomum columbianum: 48.4% (36.0); Cooperia punctata: 30.3% (94.5); Trichostrongylus axei: 22.7% (26.5); Strongyloides papillosus: 19.6% (83.0), Haemonchus contortus (L4): 7.5% (17.2), Cooperia pectinata: 10.6% (12.9), Trichuris ovis: 10.6 % (0.6); Cooperia spatulata 4.5% (0.3); Capillaria bovis: 4.5% (0.1). The mean parasitism of helminthswas 6524.7 per animal. Haemonchus contortus (adults and L4) and Trichostrongylus colubriformis corresponded to 45.4% and 46.7% of the average worm burden totally, respectively. Based in the results obtained in this study, can be concluded that the two most abundant species of helminths and important, the micro-region of Jaboticabal are Trichostrongylus colubriformis and Haemonchus contortus, and these two species amounted to 92.1% of the distribution percentage of helminths collected from all animals. These results demonstrate the importance of conducting a counts of eggs per gram of feces (EPG) in the herds of this region when FAMACHA is used on a particular property, since this method control does not allow to diagnostic the damage/clinical signs in animals infected by T. colubriformis, because this specie does not have hematophagism habit on animals.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
A utilização de novas tecnologias empregando a biologia molecular busca superar os principais problemas encontrados nas vacinas atualmente comercializadas no combate à brucelose bovina. Desta forma, a identificação de proteínas imunogênicas e a posterior transformação dos genes correspondentes em micro-organismos competentes tem sido um dos principais alvos para o desenvolvimento de novas formas de controle da infecção. O presente trabalho tem como objetivo propor, em base teórica, uma vacina de eficácia e segurança superiores às encontradas atualmente no mercado contra a brucelose bovina, antropozoonose contagiosa provocada principalmente pela espécie Brucella abortus. Essa enfermidade produz infecção característica em bovinos e bubalinos e é infecciosa ao homem, causando doença crônica que leva à incapacidade parcial ou total para o trabalho. Por ter distribuição universal, acarreta problemas sanitário e de saúde pública importantes e grandes prejuízos econômicos. A vacina proposta visa o desenvolvimento de microorganismos transformados contendo genes de proteínas de potencial imunológico que, após purificação, são usadas para o combate da doença. As proteínas recombinantes abordadas no presente estudo são as proteína ribossomal L7/L12 e a lumazina sintetase que, ao serem utilizadas em uma vacina subcelular, diferente das comercializadas atualmente, induzem resposta de longa duração, não induzem a produção de anticorpos que interfiram no diagnóstico e não são patogênicas ao homem.
Resumo:
Pós-graduação em Medicina Veterinária - FCAV
Resumo:
Pós-graduação em Medicina Veterinária - FCAV
Resumo:
Pós-graduação em Medicina Veterinária - FCAV
Resumo:
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)
Resumo:
The aim of this study was to study the seroepidemiological profile of brucellosis and leptospirosis in horses traction Island Maiandeua, state of Para. In two distinct periods, blood samples were collected from 52 animals of both sexes and different ages (2 to 17 years), totaling 104 samples. For the research of antibodies anti-Brucella abortus were used in rapid agglutination test in plate. In the first harvest, none animal was positive, however in the second harvest there were three animals reactive serum. The research of antibodies anti-Leptospira spp. was performed with the use of the microscopic agglutination test (MAT), the first harvest was 23.07% reacting animals and 15.38% at the second harvest, for one or more Leptospira spp. with titers ranging from 100 to 200. The predominant serotype at first and second harvest was the Autumnalis 40% and 37.5% respectively. According to age, it was observed in group 1 (2 to 7 years) 27.78% and 13.89% respectively in the two samples and the second group (> 7 years) was found 12.50% and 18 75% of reactive serum. The results observed in this study demonstrated that the island of Maiandeua, state of Para, there is the presence of Leptospira spp, with the most frequent serovar autumnalis and possible exposure of animals to brucella smooth, suggesting low risk of infection in the population of horses examined.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)