102 resultados para expression studies


Relevância:

100.00% 100.00%

Publicador:

Resumo:

Background: Quantitative data from gene expression experiments are often normalized by transcription levels of reference or housekeeping genes. An inherent assumption for their use is that the expression of these genes is highly uniform in living organisms during various phases of development, in different cell types and under diverse environmental conditions. To date, the validation of reference genes in plants has received very little attention and suitable reference genes have not been defined for a great number of crop species including Coffea arabica. The aim of the research reported herein was to compare the relative expression of a set of potential reference genes across different types of tissue/organ samples of coffee. We also validated the expression profiles of the selected reference genes at various stages of development and under a specific biotic stress.Results: The expression levels of five frequently used housekeeping genes (reference genes), namely alcohol dehydrogenase (adh), 14-3-3, polyubiquitin (poly), beta-actin (actin) and glyceraldehyde-3-phosphate dehydrogenase (gapdh) was assessed by quantitative real-time RT-PCR over a set of five tissue/organ samples (root, stem, leaf, flower, and fruits) of Coffea arabica plants. In addition to these commonly used internal controls, three other genes encoding a cysteine proteinase (cys), a caffeine synthase (ccs) and the 60S ribosomal protein L7 (rpl7) were also tested. Their stability and suitability as reference genes were validated by geNorm, NormFinder and BestKeeper programs. The obtained results revealed significantly variable expression levels of all reference genes analyzed, with the exception of gapdh, which showed no significant changes in expression among the investigated experimental conditions.Conclusion: Our data suggests that the expression of housekeeping genes is not completely stable in coffee. Based on our results, gapdh, followed by 14-3-3 and rpl7 were found to be homogeneously expressed and are therefore adequate for normalization purposes, showing equivalent transcript levels in different tissue/ organ samples. Gapdh is therefore the recommended reference gene for measuring gene expression in Coffea arabica. Its use will enable more accurate and reliable normalization of tissue/organ-specific gene expression studies in this important cherry crop plant.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Background: Rust caused by Puccinia psidii Winter has been limiting for the establishment of new Eucalyptus plantations, as well as for resprouting of susceptible genetic materials. Identifying host genes involved in defense responses is important to elucidate resistance mechanisms. Reverse transcription-quantitative PCR is the most common method of mRNA quantitation for gene expression analysis. This method generally employs a reference gene as an internal control to normalize results. A good endogenous control transcript shows minimal variation due to experimental conditions. Findings. We analyzed the expression of 13 genes to identify transcripts with minimal variation in leaves of 60-day-old clonal seedlings of two Eucalyptus clones (rust-resistant and susceptible) subjected to biotic (P. psidii) and abiotic (acibenzolar-S-methyl, ASM) stresses. Conclusions. For tissue samples of clones that did not receive any stimulus, a combination of the eEF2 and EglDH genes was the best control for normalization. When pathogen-inoculated and uninoculated plant samples were compared, eEF2 and UBQ together were more appropriate as normalizers. In ASM-treated and untreated leaves of both clones, transcripts of the CYP and elF4B genes combined were the ones with minimal variation. Finally, when comparing expression in both clones for ASM-treated leaves, P. psidii-inoculated leaves, ASM-treated plus P. psidii-inoculated leaves, and their respective controls, the genes with the most stable expression were EgIDH and UBQ. The chitinase gene, which is highly expressed in studies on plant resistance to phytopathogens, was used to confirm variation in gene expression due to the treatments. © 2010 Laia et al; licensee BioMed Central Ltd.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Relevância:

70.00% 70.00%

Publicador:

Resumo:

The objective of this work was to assess the functionality of the glycolytic pathways in the bacterium Xylella fastidiosa. To this effect, the enzymes phosphoglucose isomerase, aldolase, glyceraldehyde-3-phosphate dehydrogenase and pyruvate kinase of the glycolytic pathway, and glucose 6-phosphate dehydrogenase of the Entner-Doudoroff pathway were studied, followed by cloning and expression studies of the enolase gene and determination of its activity. These studies showed that X. fastidiosa does not use the glycolytic pathway to metabolize carbohydrates, which explains the increased duplication time of this phytopatogen. Recombinant enolase was expressed as inclusion bodies and solubilized with urea (most efficient extractor), Triton X-100, and TCA. Enolase extracted from X. fastidiosa and from chicken muscle and liver is irreversibly inactivated by urea. The purification of enolase was partial and resulted in a low yield. No enzymatic activity was detected for either recombinant and native enolases, aldolase, and glyceraldehyde-3-phosphate dehydrogenase, suggesting that X. fastidiosa uses the Entner-Doudoroff pathway to produce pyruvate. Evidence is presented supporting the idea that the regulation of genes and the presence of isoforms with regulation patterns might make it difficult to understand the metabolism of carbohydrates in X. fastidiosa.

Relevância:

70.00% 70.00%

Publicador:

Resumo:

Objective:Gene expression studies have revealed several molecular subtypes of breast carcinoma with distinct clinical and biological behaviours. DNA microarray studies correlated with immunohistochemical profiling of breast carcinomas using cytokeratin (CK) markers, Her2/neu, oestrogen receptor (ER), and basal myoepithelial cell markers have identified five breast tumour subtypes: (i) luminal A (ER+; Her2/neu-), (ii) luminal B (ER+; Her2/neu+), (iii) Her2 overexpression (ER-; Her2/neu+), (iv) basal-like (ER-; Her2/neu-, CK5/6 and 14+), and (v) negative for all markers. Luminal carcinomas express cytokeratins in a luminal pattern (CK8/18), and the basal-like type expresses CK5/6 and CK14 or basal epithelial cell markers. CK5/6, CK8/18, and smooth muscle actin (SMA) expression were assessed in cell blocks and compared with expression in surgical specimens.Methods:Sixty-two cases of breast carcinoma diagnosed by fine needle aspiration cytology with cell blocks and available surgical specimens were included. Cell blocks containing at least 10 high-power fields each with at least 10 tumour cells and surgical specimens were immunostained for CK5/6, CK8/18 and SMA.Results:Percentage sensitivity, specificity, positive predictive value, negative predictive value and accuracy were, respectively, 77, 100, 100, 92 and 94 for CK5/6; 98, 66, 96, 80 and 95 for CK8/18; and 92, 96, 85, 98 and 95 for SMA.Conclusion:The identification of CK5/6, CK8/18 and SMA by immunohistochemistry in cell blocks can be a reliable method that yields results close to those obtained in surgical specimens, and can contribute to the classification of breast carcinomas with luminal and basal expression patterns, providing helpful information in the choice of treatment and in the evaluation of prognostic and predictive factors.

Relevância:

70.00% 70.00%

Publicador:

Resumo:

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Relevância:

70.00% 70.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

A cDNA clone (designated ZmPUMP) encoding an uncoupling protein (UCP) from maize (Zea mays) was identified by searching for homologous sequences among the expressed sequence tags of the GenBank database. The ZmPUMP cDNA contains a single open reading frame of 933 nucleotides encoding 310 amino acids. Several features identified the predicted ZmPUMP protein as a member of the mitochondrial UCP subfamily of mitochondrial carriers. Expression studies demonstrated that ZmPUMP is ubiquitously expressed in maize tissues and its transcript level is not altered in early stages of embryo germination. In contrast to known UCP genes, ZmPUMP is not responsive to cold stress. Instead its expression is increased in response to H 2O 2- or menadione-induced oxidative stress. © 2003 Elsevier Science Ireland Ltd. All rights reserved.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Pós-graduação em Ginecologia, Obstetrícia e Mastologia - FMB

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)