89 resultados para Hemangioma capilar


Relevância:

70.00% 70.00%

Publicador:

Resumo:

Contexto: Os hemangiomas infantis são os tumores vasculares benignos mais comuns da infância e representam um desafio em relação ao tratamento.Descrição do caso: Descrevemos o caso de uma criança do sexo masculino, de quatro meses de idade, que apresentava um hemangioma de grande extensão na região cervical direita.Discussão: Apresentamos as diversas formas de tratamento dos hemangiomas da infância, com ênfase no tratamento com betabloqueadores sistêmicos.Conclusões: Apesar de o diagnóstico dos hemangiomas infantis não apresentar complexidade, há várias formas de tratamento, com base na localização, no tamanho e nas complicações possíveis de cada lesão em particular.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Kassabach-Merritt syndrome is a combination of capillary hemangioma and thrombocytopenia that predisposes to bleeding with petechiae, ecchymosis and spontaneous bruising. Treatment is generally started with corticosteroids, interferon alpha or chemotherapy. We present the case of a child (aged 1 year and 9 months) with a giant hemangioma, from the root of the thigh to the knee, and thrombocytopenia. Treatment was started with corticosteroids, without improvement, and then intra-tumor and cutaneous bleeding appeared spontaneously. The patient’s clinical condition precluded prescription of vincristine and interferon and emergency tumor resection was conducted because of extreme thrombocytopenia and bleeding. The child then began to develop sepsis with hypotension and ischemia of remnant tissues. This case presented a therapeutic challenge, which is the subject of this article.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Primary cardiac tumors are rare, with an incidence range between 0.001% and 0.030% at autopsy. Recent technical advances have facilitated diagnosis and surgical treatment of such lesions. Patients with a resectable tumor usually have a good prognosis, but patients with an unresectable tumor may have a poor prognosis. This report shows a case of right atrial hemangioma growing like an extracardiac mass, with cardiac tamponade the only clinical presentation.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Hemangioma of urinary tract are unusual, being about 2 % of all hemangiomas. We present a case of a glans penis hemangioma. There is controversy concerning their treatment and outcome. Our patient was treated with a Neodymium : Yag laser irradiation, with complete morphological recuperation.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

20.00% 20.00%

Publicador:

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Leptospira pomona diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with Leptospira pomona (10 0 to 10 7 bacteria/ ml) and DNA was extracted by phenol/chloroform protocol. DNA fragments visualization was done by three electrophoresis methods: under UV light in 2 % agarose gel, silver staining 8% polyacrylamide gel and fluorescent capillary electrophoresis. The detection limit of capillary electrophoresis for Leptospira pomona was 10 2bacteria/ml. Under UV light, in 2 % agarose gel, the detection limit was of 10 4 bacteria/ ml while for silver stained 8 % polyacrylamide gel it was 10 2 bacteria/ ml. PCR with fluorescent capillary electrophoresis is an efficient and rapid diagnostic test for DNA detection of Leptospira in bovine semen and this can be an important tool for herd and semen sanitary control in artificial insemination centers.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Hemangiomas are benign tumors of infancy and childhood, characterized by a phase of fast growth with endothelial cell proliferation, occurring in 10-12% of children at 1 year of age. It is known that hemangiomas of infancy are most commonly located on the head and neck region (around 60% of cases) and occur more frequently in the lips, tongue, and palate. Approximately 50% of hemangiomas have complete resolution, and 90% of them are resolved up to the age of 9. Complications occur in only 20% of the cases, the most common problem being ulceration with or without infection. The treatment depends on lesion location, size and evolution stage, and the patient's age. Surgery is usually indicated when there is no response to systemic treatments, or even for esthetic reasons, being performed as a simple excision in combination or not with plastic surgery. This paper reports a case of lip cavernous hemangioma in a 4-year-old child, who was submitted to 3 sessions of vascular sclerosis due to the size of the lesion, before undergoing simple excision of the hemangioma. Two years of postoperative clinical follow-up shows treatment success with no recurrence of the lesion.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Pós-graduação em Enfermagem (mestrado profissional) - FMB

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.