150 resultados para ALFA
Resumo:
No presente trabalho, foram utilizadas 21 fêmeas suínas, virgens, sexualmente aptas, criadas e mantidas sob condições industriais, para observação dos perfis hormonais séricos de 17-alfa-OH progesterona e androstenediona, durante o ciclo estral. As colheitas de sangue foram efetuadas sempre no mesmo intervalo, entre 8 e 10 horas. Cada animal foi submetido a 14 punções venosas, distribuídas nos dias zero, 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 21, 22 e 23 do ciclo estral. Considerou-se o dia zero como o primeiro dia da fase estral, e o 23º dia como o primeiro do estro subseqüente. Os ensaios para dosagens hormonais foram executados utilizando-se a técnica de radioimunoensaio (RIE) em fase sólida e para isso foi empregado conjunto de reagentes comerciais (Coat-A-Count®). Para o hormônio 17-alfa-OH progesterona, foram encontrados valores médios que variaram entre 0,18 e 2,7 ng/ml e para o hormônio androstenediona esses valores oscilaram entre 0,08 e 0,24 ng/ml.
Resumo:
Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Avaliou-se a inibição da produção do fator de necrose tumoral alfa (TNF-alfa) devido ao pré-tratamento com antiinflamatório esteroidal (dexametasona) e não esteroidal (diclofenaco sódico) em eqüinos com endotoxemia induzida experimentalmente. Foram utilizados 15 cavalos machos não castrados, distribuídos em três grupos de cinco animais: controle (C), diclofenaco sódico (DS) e dexametasona (DM). A endotoxemia subletal foi induzida pela infusão intravenosa (IV) de 0,1mg/kg/pv de lipopolissacarídeo (LPS) de Escherichia coli 055:B5, administrado em 250ml de solução estéril de cloreto de sódio a 0,9%, durante 15min. Os cavalos do grupo-controle foram tratados com solução de cloreto de sódio a 9% IV. Nos animais do grupo DS, administraram-se, por via oral, 2,2mg/kg de diclofenaco sódico e, nos do grupo DM, 1,1mg/kg de dexametasona IV, respectivamente, 60 e 30min antes da infusão da endotoxina. Mensurou-se, por meio de ensaio de toxicidade com células da linhagem L929, a concentração de TNF-alfa no soro e no líquido peritoneal às 0, 1¼, 3 e 6 horas após injeção do LPS. No grupo-controle, observou-se aumento significativo de TNF-alfa sérico, em relação ao valor basal e aos grupos DS e DM, 1,15 horas após a indução da endotoxemia. No líquido peritoneal, as concentrações observadas estavam abaixo daquelas da curva padrão de TNF-alfa, não havendo diferença entre os grupos (P>0,05).
Resumo:
A talassemia alfa é uma anemia hereditária resultante da síntese deficiente de cadeias alfa, provocando um excesso relativo de cadeias beta, que vão formar tetrâmeros identificados como hemoglobina H (Hb H) no indivíduo adulto. Para direcionar o diagnóstico laboratorial desta anemia, a análise dos índices eritrocitários, a eletroforese em acetato de celulose em pH neutro e a pesquisa de corpos de inclusão de Hb H são essenciais. O objetivo deste estudo foi traçar o perfil hematológico, por meio dos índices eritrocitários, dos portadores de talassemia alfa das regiões Sudeste e Nordeste do Brasil. Foram analisadas 1.010 amostras de sangue periférico após consentimento informado. Os índices eritrocitários como contagem de glóbulos vermelhos (RBC), dosagem de hemoglobina (HGB), hematócrito (HCT), volume corpuscular médio (VCM), hemoglobina corpuscular média (HCM) e concentração de hemoglobina corpuscular média (CHCM) foram fornecidos por aparelhos automatizados com controle de qualidade interno e externo. Para o diagnóstico de talassemia alfa foram utilizados testes de triagem e complementares para talassemias, como eletroforese em pH neutro e pesquisa de corpos de inclusão de Hb H com coloração de azul cresil brilhante. Comparando-se os valores hematológicos observados nos dois grupos, notou-se que, em ambas as regiões, os índices com valores discrepantes foram os níveis de HGB e HCT, sendo a maior freqüência de variação observada entre as mulheres. Nos portadores do fenótipo alfa talassêmico da região Nordeste, todos os índices eritrocitários estavam abaixo dos valores de normalidade. Estes resultados evidenciam a necessidade de melhor avaliação do perfil hematológico de talassemia alfa em diferentes regiões, considerando-se os interferentes ambientais para um diagnóstico mais preciso.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
O presente trabalho teve por objetivo analisar a influência do desenvolvimento etário e da suplementação com acetato de DL-alfa-tocoferol sobre o metabolismo oxidativo de neutrófilos, em bovinos da raça holandesa, no período do nascimento até os 150 dias de idade. Foram utilizados 20 bezerros divididos em dois grupos de dez animais. Os animais do grupo Tratamento receberam 2000UI de acetato de DL-alfa-tocoferol, por via intramuscular, ao nascimento, aos 15, 30, 60, 90 e 120 dias de idade, sendo o outro o grupo Controle, que não recebeu qualquer suplementação. em ambos os grupos, o metabolismo oxidativo dos neutrófilos demonstrou pouca atividade durante os primeiros 60 dias de vida, sendo indicativo da ineficiência deste importante mecanismo bactericida. Não foi observado efeito significativo da administração do acetato de DL-alfa-tocoferol sobre o metabolismo oxidativo de neutrófilos.
Resumo:
The combination of pegylated interferon (PEG-INF) and ribavirin is currently the best treatment for chronic hepatitis C, providing a sustained virological response (SVR) in 54%-63% of patients. In patients infected with hepatitis C virus (HCV) genotype 1, the SVR rate is 42%-52%. To evaluate the treatment efficacy of this drug combination, we conducted an open, prospective study of 58 consecutive treatment-naive patients infected with HCV genotype 1 and treated at a university hospital, comparing those presenting an SVR (SVRs), nonresponders (NRs), and relapsers (RELs). Among the intent-to-treat patients, an end-of-treatment virological response was achieved in 69 % of the sample as a whole and in 52 % of the SVRs. We found that being an SVR was significantly associated with mild fibrosis (p = 0.04) and with undetectable HCV RNA at weeks 12 and 24 of treatment (p < 0.0001). Comparing the SVR and REL groups, we observed that being older than 40 was significantly associated with being a REL (p = 0.04). Being an NR was found to be associated with severe fibrosis and moderate inflammatory infiltrates (portal or periportal). In the polytomous logistic regression, no independent factors were associated with the REL group when compared with the SVR group. We conclude that RELs and NRs differ in comparison with SVRs. The RELs accounted for 17% of the sample. The HCV RNA test results at weeks 12 and 24 of treatment, although independent predictors of non-response (OR: 4.8 and 8.2, respectively), did not differ between SVRs and RELs.
Resumo:
The technique of isotope dilution has been extensively utilized for determining the content of trace elements in geological samples; it has been especially useful for the determination of 238U and 234U contents in crustal materials with measurements made by alpha spectrometry. 232U-228Th has usually been used as diluent (spike) during the application of this analytical technique. More recently, 236U and 229Th have been used. Some methodological problems concerning the utilization of these spikes are presented with examples of experimental data obtained in analyses of groundwater and borehole spoil samples from Morro do Ferro, Pocos de Caldas (MG). -from English summary
Resumo:
Sickle Cell disease is a generic term for a group of genetic disorders characterized by the predominance of hemoglobin S. These disorders include Sickle Cell anemia, the Sickle Cell beta Thalassemia syndromes and Hemoglobinopathies in which hemoglobin S is in association with another abnormal hemoglobin, such as hemoglobin S/C. The Sickle Cell trait (hemoglobin AS) associated with Alpha Thalassemia presents alterations in the red blood cells morphology, usually absent in the heterozygous for this hemoglobin variant. The interaction between hemoglobin Sand alpha Thalassemia has been described as one of the factors responsible for the improvement in the clinical picture of homozygous of hemoglobin S (Sickle Cell Anemia), decreasing the number of episodes of pain. The genetic mechanisms of this influence are evaluated using molecular analyses of the human globin genes. With the objective of verifying the presence of alpha Thalassemia in heterozygous of hemoglobin S, with anemia, sent to the Laboratory of Hemoglobins, Department of Biology, UNESP, São José do Rio Preto, SP, we analyzed 1002 blood samples with Sickle Cell trait, in the period from 1990 to 1998. The samples were picked with EDTA 5% as anticoagulant, after previous authorization of the carriers. Appropriated counseling and management requires definitive diagnosis. For the laboratorial diagnosis the blood samples were submitted to electrophoretic procedures in alkaline and acid pH and cytological evaluation of hemoglobin H. The electrophoretic procedures confirmed the presence of hemoglobin AS. The cytological evaluation evidenced the presence of alpha Thalassemia. Of this total analyzed, 16(1,59%) blood samples presented the association between hemoglobin AS and alpha Thalassemia and two individuals belonged of the same family. Our results addressed us to suggest to the routine laboratories, that is important to accomplish the research of alpha Thalassemia among the Sickle Cell trait, with anemia, to verify the interaction with alpha Thalassemia, supplying to the carriers a important information on its hematological profile, genetic pattern of hemoglobinopathies and the appropriated counseling. Rev.bras.hematol.hemoter.,2000,22(3):388-394.
Resumo:
Background: Health-related quality of life (HRQOL) measurements provide valuable information about the psychological and social impact of treatment on patients with cystic fibrosis (CF). This study evaluated the HRQOL of Brazilian patients with CF and assessed the changes in HRQOL domains over 1 year after dornase alfa (Pulmozyme) introduction. Patients and Methods: One hundred fifty-six stable patients with CF and 89 caregivers answered the Portuguese-validated version of the Cystic Fibrosis Questionnaire-Revised (CFQ-R) at baseline (T 0), and at 3 (T 1), 6 (T 2), 9 (T 3), and 12 (T 4) months of follow-up. Eighteen patientswere excluded because they did not fulfill the inclusion criteria. The patients were analyzed in two groups: those aged 6-11 years and those aged 14 years and older. ANOVA for observed repeated results and the last observation carried forward (LOCF) method for missing data were used for the statistical analysis. Results: After 1 year of follow-up, there was significant improvement in respiratory symptoms (T 4-T 0=8.1; 95% confidence interval (95% CI)=[2.1;14.0]; effect size (ES)=0.35; P<0.001), Emotional Functioning (T 4-T 0=5.6; 95% CI=[1.1;10.1]; ES=0.31; P<0.05), Social Functioning (T 4-T 0=6.0; 95% CI=[1.3;11.7]; ES=0.31; P<0.05), Body Image (T 4-T 0=11.9; 95% CI=[4.1;19.7]; ES=0.42; P<0.05), and Treatment Burden (T 4-T 0=5.3; 95% CI=[0.3;10.3]; ES=0.24; P<0.05) domains in the younger group. A significant improvement in Role Functioning (T 4-T 0=6.1; 95% CI=[1.1;11.1]; ES=0.40; P<0.05), Body Image (T 4-T 0=12.6; 95% CI=[3.5;21.7]; ES=0.46; P<0.05), and Weight (T 4-T 0=11.7; 95% CI=[1.8;21.6]; ES=0.40; P<0.05) was obtained in the older group. The caregivers' CFQ-R showed improvements in the Digestive Symptoms (T 4-T 0=5.5; 95% CI=[1.5;9.4]; ES=0.30; P<0.05), Respiratory Symptoms (T 4-T 0=7.6; 95% CI=[3.9;11.4]; ES=0.48; P<0.05), and Weight (T 4-T 0=10.1; 95% CI=[1.6;18.6]; ES=0.26; P<0.05) domains. Conclusion: The introduction of dornase alfa improved the HRQL of the patients with CF during the first year of treatment. © 2010 Wiley-Liss, Inc.
Resumo:
Background & Aims Patients infected with hepatitis C virus (HCV) genotype 1, body weight <85 kg, and high baseline viral load respond poorly to standard doses of pegylated interferon (peginterferon) and ribavirin. We evaluated intensified therapy with peginterferon alfa-2a plus ribavirin. Methods This double-blind randomized trial included HCV genotype 1-infected outpatients from hepatology clinics with body weight <85 kg and HCV RNA titer <400,000 IU/mL. Patients were randomized to 180 μg/wk peginterferon alfa-2a for 48 weeks plus 1200 mg/day ribavirin (standard of care) (group A, n = 191) or 1400/1600 mg/day ribavirin (group B, n = 189). Additional groups included 360 μg/wk peginterferon alfa-2a for 12 weeks then 180 μg/wk peginterferon alfa-2a for 36 weeks plus 1200 mg/day ribavirin (group C, n = 382) or 1400/1600 mg/day ribavirin (group D, n = 383). Follow-up lasted 24 weeks after treatment. Results Sustained virologic response rates (HCV RNA level <15 IU/mL at end of follow-up) in groups A, B, C, and D were 38%, 43%, 44%, and 41%, respectively. There were no significant differences among the 4 groups or between pooled peginterferon alfa-2a regimens (A + B vs C + D: odds ratio [OR], 1.08; 95% confidence interval [CI], 0.831.39; P = .584) or pooled ribavirin regimens (A + C vs B + D: OR, 1.00; 95% CI, 0.791.28; P = .974). Conclusions In patients infected with HCV genotype 1 who are difficult to treat (high viral load, body weight <85 kg), a 12-week induction regimen of peginterferon alfa-2a and/or higher-dose ribavirin is not more effective than the standard regimen. © 2010 AGA Institute.