Stepwise self-assembly of a tripeptide from molecular dimers to supramolecular beta-sheets in crystals and amyloid-like fibrils in the solid state

The terminally protected tripeptide Boc-Ala(1)-Leu(2)-Ala(3)-OMe 1 forms antiparallel hydrogen-bonded dimers of two different conformers in the asymmetric unit and the individual dimers then self-associate to form supramolecular beta-sheet structures in crystals and amyloid-like fibrils in the solid state.

Supramolecular helix and beta-sheet through self-assembly of two isomeric tetrapeptides in crystals and formation of filaments and ribbons in the solid state

Single crystal X-ray diffraction studies show that the beta-turn structure of tetrapeptide I, Boc-Gly-Phe-Aib-Leu-OMe (Aib: alpha-amino isobutyric acid) self-assembles to a supramolecular helix through intermolecular hydrogen bonding along the crystallographic a axis. By contrast the beta-turn structure of an isomeric tetrapeptide II, Boc-Gly-Leu-Aib-Phe-OMe self-assembles to a supramolecular beta-sheet-like structure via a two-dimensional (a, b axis) intermolecular hydrogen bonding network and pi-pi interactions. FT-IR studies of the peptides revealed that both of them form intermolecularly hydrogen bonded supramolecular structures in the solid state. Field emission scanning electron micrographs (FE-SEM) of the dried fibrous materials of the peptides show different morphologies, non-twisted filaments in case of peptide I and non-twisted filaments and ribbon-like structures in case of peptide II.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Impact of geographical region on urinary metabolomic and plasma fatty acid profiles in subjects with the metabolic syndrome across Europe: the LIPGENE study

The application of metabolomics in multi-centre studies is increasing. The aim of the present study was to assess the effects of geographical location on the metabolic profiles of individuals with the metabolic syndrome. Blood and urine samples were collected from 219 adults from seven European centres participating in the LIPGENE project (Diet, genomics and the metabolic syndrome: an integrated nutrition, agro-food, social and economic analysis). Nutrient intakes, BMI, waist:hip ratio, blood pressure, and plasma glucose, insulin and blood lipid levels were assessed. Plasma fatty acid levels and urine were assessed using a metabolomic technique. The separation of three European geographical groups (NW, northwest; NE, northeast; SW, southwest) was identified using partial least-squares discriminant analysis models for urine (R 2 X: 0•33, Q 2: 0•39) and plasma fatty acid (R 2 X: 0•32, Q 2: 0•60) data. The NW group was characterised by higher levels of urinary hippurate and N-methylnicotinate. The NE group was characterised by higher levels of urinary creatine and citrate and plasma EPA (20 : 5 n-3). The SW group was characterised by higher levels of urinary trimethylamine oxide and lower levels of plasma EPA. The indicators of metabolic health appeared to be consistent across the groups. The SW group had higher intakes of total fat and MUFA compared with both the NW and NE groups (P≤ 0•001). The NE group had higher intakes of fibre and n-3 and n-6 fatty acids compared with both the NW and SW groups (all P< 0•001). It is likely that differences in dietary intakes contributed to the separation of the three groups. Evaluation of geographical factors including diet should be considered in the interpretation of metabolomic data from multi-centre studies.

Rayleigh scattering by hexagonal ice crystals and the interpretation of dual-polarisation radar measurements

Dual-polarisation radar measurements provide valuable information about the shapes and orientations of atmospheric ice particles. For quantitative interpretation of these data in the Rayleigh regime, common practice is to approximate the true ice crystal shape with that of a spheroid. Calculations using the discrete dipole approximation for a wide range of crystal aspect ratios demonstrate that approximating hexagonal plates as spheroids leads to significant errors in the predicted differential reflectivity, by as much as 1.5 dB. An empirical modification of the shape factors in Gans's spheroid theory was made using the numerical data. The resulting simple expressions, like Gans's theory, can be applied to crystals in any desired orientation, illuminated by an arbitrarily polarised wave, but are much more accurate for hexagonal particles. Calculations of the scattering from more complex branched and dendritic crystals indicate that these may be accurately modelled using the new expression, but with a reduced permittivity dependent on the volume of ice relative to an enclosing hexagonal prism.

The effect of dietary nitrate on salivary, plasma, and urinary nitrate metabolism in humans

Dietary nitrate is metabolized to nitrite by bacterial flora on the posterior surface of the tongue leading to increased salivary nitrite concentrations. In the acidic environment of the stomach, nitrite forms nitrous acid, a potent nitrating/nitrosating agent. The aim of this study was to examine the pharmacokinetics of dietary nitrate in relation to the formation of salivary, plasma, and urinary nitrite and nitrate in healthy subjects. A secondary aim was to determine whether dietary nitrate increases the formation of protein-bound 3-nitrotyrosine in plasma, and if dietary nitrate improves platelet function. The pharmacokinetic profile of urinary nitrate excretion indicates total clearance of consumed nitrate in a 24 h period. While urinary, salivary, and plasma nitrate concentrations increased between 4- and 7-fold, a significant increase in nitrite was only detected in saliva (7-fold). High dietary nitrate consumption does not cause a significant acute change in plasma concentrations of 3-nitrotyrosine or in platelet function.

The influence of viscous and latent heating on crystal-rich magma flow in a conduit

The flow dynamics of crystal-rich high-viscosity magma is likely to be strongly influenced by viscous and latent heat release. Viscous heating is observed to play an important role in the dynamics of fluids with temperature-dependent viscosities. The growth of microlite crystals and the accompanying release of latent heat should play a similar role in raising fluid temperatures. Earlier models of viscous heating in magmas have shown the potential for unstable (thermal runaway) flow as described by a Gruntfest number, using an Arrhenius temperature dependence for the viscosity, but have not considered crystal growth or latent heating. We present a theoretical model for magma flow in an axisymmetric conduit and consider both heating effects using Finite Element Method techniques. We consider a constant mass flux in a 1-D infinitesimal conduit segment with isothermal and adiabatic boundary conditions and Newtonian and non-Newtonian magma flow properties. We find that the growth of crystals acts to stabilize the flow field and make the magma less likely to experience a thermal runaway. The additional heating influences crystal growth and can counteract supercooling from degassing-induced crystallization and drive the residual melt composition back towards the liquidus temperature. We illustrate the models with results generated using parameters appropriate for the andesite lava dome-forming eruption at Soufriere Hills Volcano, Montserrat. These results emphasize the radial variability of the magma. Both viscous and latent heating effects are shown to be capable of playing a significant role in the eruption dynamics of Soufriere Hills Volcano. Latent heating is a factor in the top two kilometres of the conduit and may be responsible for relatively short-term (days) transients. Viscous heating is less restricted spatially, but because thermal runaway requires periods of hundreds of days to be achieved, the process is likely to be interrupted. Our models show that thermal evolution of the conduit walls could lead to an increase in the effective diameter of flow and an increase in flux at constant magma pressure.

Barley oxalate oxidase is a hexameric protein related to seed storage proteins: evidence from X-ray crystallography

The oxalate oxidase enzyme expressed in barley roots is a thermostable, protease-resistant enzyme that generates H2O2. It has great medical importance because of its use to assay plasma and urinary oxalate, and it has also been used to generate transgenic, pathogen-resistant crops. This protein has now been purified and three types of crystals grown. X-ray analysis shows that the symmetry present in these crystals is consistent with a hexameric arrangement of subunits, probably a trimer of dimers. This structure may be similar to that found in the related seed storage proteins.

Cobalt(III) complexes of some aromatic thiohydrazides – Synthesis, characterization and structure

Co(NH3)(5)Cl]Cl-2 forms neutral 1:3 complex by reaction with aromatic thiohydrazides, i.e. thiobenzhydrazide, o-hydroxythiobenzhydrazide, thiophen-2-thiohydrazide and furan-2-thiohydrazide. All these complexes are diamagnetic and have been characterized by elemental analysis and combination of spectroscopic methods. Cyclic voltammometry of the complexes shows irreversible metal centered and ligand centered electron transfer reactions. One complex, tris-o-hydroxythiobenzhydrazidocobalt(III),has been crystallized from DMSO solution to produce solvated crystals and its structure has been established by X-ray crystallography. Cobalt(III) ion is linked through three hydrazinic nitrogen and three sulfur atoms of three identical deprotonated ligand molecules in a distorted octahedral environment. Involvement of -OH group in intramolecular and intermolecular hydrogen bonding is crucial for crystal formation.

Evolution of network structure in polymer-stabilised liquid crystals

Experiments were performed to investigate the evolution of structure and morphology of the network in polymer-stabilised liquid crystals. In situ optical microscopy revealed that the morphology was significantly altered by extraction of the LC host, while scanning electron microscopy showed that the network morphology was also dependent on the polymerisation conditions and closely related to the depletion of monomer, as monitored by high performance liquid chromatography. Transmission electron microscopy allowed observation of internal structure, resolving microstructure on the order of 0. 1 μm.

A novel study of the polymerisation process involved in the formation of the network component of polymer-stabilised liquid crystals within electro-optic cells using high performance liquid chromatography

Polymer-stabilised liquid crystals are systems in which a small amount of monomer is dissolved within a liquid crystalline host, and then polymerised in situ to produce a network. The progress of the polymerisation, performed within electro-optic cells, was studied by establishing an analytical method novel to these systems. Samples were prepared by photopolymerisation of the monomer under well-defined reaction conditions; subsequent immersion in acetone caused the host and any unreacted monomer to dissolve. High performance liquid chromatography was used to separate and detect the various solutes in the resulting solutions, enabling the amount of unreacted monomer for a given set of conditions to be quantified. Longer irradiations cause a decrease in the proportion of unreacted monomer since more network is formed, while a more uniform LC director alignment (achieved by decreasing the sample thickness) or a higher level of order (achieved by decreasing the polymerisation temperature) promotes faster reactions.

The three-dimensional morphology of simulated and observed convective storms over southern England

A set of high-resolution radar observations of convective storms has been collected to evaluate such storms in the UK Met Office Unified Model during the DYMECS project (Dynamical and Microphysical Evolution of Convective Storms). The 3-GHz Chilbolton Advanced Meteorological Radar was set up with a scan-scheduling algorithm to automatically track convective storms identified in real-time from the operational rainfall radar network. More than 1,000 storm observations gathered over fifteen days in 2011 and 2012 are used to evaluate the model under various synoptic conditions supporting convection. In terms of the detailed three-dimensional morphology, storms in the 1500-m grid-length simulations are shown to produce horizontal structures a factor 1.5–2 wider compared to radar observations. A set of nested model runs at grid lengths down to 100m show that the models converge in terms of storm width, but the storm structures in the simulations with the smallest grid lengths are too narrow and too intense compared to the radar observations. The modelled storms were surrounded by a region of drizzle without ice reflectivities above 0 dBZ aloft, which was related to the dominance of ice crystals and was improved by allowing only aggregates as an ice particle habit. Simulations with graupel outperformed the standard configuration for heavy-rain profiles, but the storm structures were a factor 2 too wide and the convective cores 2 km too deep.

The validation of a computer-based food record for older adults: the Novel Assessment of Nutrition and Ageing (NANA) method

Dietary assessment in older adults can be challenging. The Novel Assessment of Nutrition and Ageing (NANA) method is a touch-screen computer-based food record that enables older adults to record their dietary intakes. The objective of the present study was to assess the relative validity of the NANA method for dietary assessment in older adults. For this purpose, three studies were conducted in which a total of ninety-four older adults (aged 65–89 years) used the NANA method of dietary assessment. On a separate occasion, participants completed a 4 d estimated food diary. Blood and 24 h urine samples were also collected from seventy-six of the volunteers for the analysis of biomarkers of nutrient intake. The results from all the three studies were combined, and nutrient intake data collected using the NANA method were compared against the 4 d estimated food diary and biomarkers of nutrient intake. Bland–Altman analysis showed a reasonable agreement between the dietary assessment methods for energy and macronutrient intake; however, there were small, but significant, differences for energy and protein intake, reflecting the tendency for the NANA method to record marginally lower energy intakes. Significant positive correlations were observed between urinary urea and dietary protein intake using both the NANA and the 4 d estimated food diary methods, and between plasma ascorbic acid and dietary vitamin C intake using the NANA method. The results demonstrate the feasibility of computer-based dietary assessment in older adults, and suggest that the NANA method is comparable to the 4 d estimated food diary, and could be used as an alternative to the food diary for the short-term assessment of an individual’s dietary intake.