18 resultados para diffraction des rayons-X

em CentAUR: Central Archive University of Reading - UK


Relevância:

100.00% 100.00%

Publicador:

Resumo:

The development of protocols for the identification of metal phosphates in phosphate-treated, metal-contaminated soils is a necessary yet problematical step in the validation of remediation schemes involving immobilization of metals as phosphate phases. The potential for Raman spectroscopy to be applied to the identification of these phosphates in soils has yet to be fully explored. With this in mind, a range of synthetic mixed-metal hydroxylapatites has been characterized and added to soils at known concentrations for analysis using both bulk X-ray powder diffraction (XRD) and Raman spectroscopy. Mixed-metal hydroxylapatites in the binary series Ca-Cd, Ca-Pb, Ca-Sr and Cd-Pb synthesized in the presence of acetate and carbonate ions, were characterized using a range of analytical techniques including XRD, analytical scanning electron microscopy (SEM), infrared spectroscopy (IR), inductively coupled plasma-atomic emission spectrometry (ICP-AES) and Raman spectroscopy. Only the Ca-Cd series displays complete solid solution, although under the synthesis conditions of this study the Cd-5(PO4)(3)OH end member could not be synthesized as a pure phase. Within the Ca-Cd series the cell parameters, IR active modes and Raman active bands vary linearly as a function of Cd content. X-ray diffraction and extended X-ray absorption fine structure spectroscopy (EXAFS) suggest that the Cd is distributed across both the Ca(1) and Ca(2) sites, even at low Cd concentrations. In order to explore the likely detection limits for mixed-metal phosphates in soils for XRD and Raman spectroscopy, soils doped with mixed-metal hydroxylapatites at concentrations of 5, 1 and 0.5 wt.% were then studied. X-ray diffraction could not confirm unambiguously the presence or identity of mixed-metal phosphates in soils at concentrations below 5 wt.%. Raman spectroscopy proved a far more sensitive method for the identification of mixed-metal hydroxylapatites in soils, which could positively identify the presence of such phases in soils at all the dopant concentrations used in this study. Moreover, Raman spectroscopy could also provide an accurate assessment of the degree of chemical substitution in the hydroxylapatites even when present in soils at concentrations as low as 0.1%.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Enantio-specific interactions on intrinsically chiral or chirally modified surfaces can be identified experimentally via comparison of the adsorption geometries of similar nonchiral and chiral molecules. Information about the effects of substrate-related and in interactions on the adsorption geometry of glycine, the only natural nonchiral amino acid, is therefore important for identifying enantio-specific interactions of larger chiral amino acids. We have studied the long- and short-range adsorption geometry and bonding properties of glycine on the intrinsically chiral Cu{531} surface with low-energy electron diffraction, near-edge X-ray absorption One structure spectroscopy, X-ray photoelectron spectroscopy, and temperature-programmed desorption. For coverages between 0.15 and 0.33 ML (saturated chemisorbed layer) and temperatures between 300 and 430 K, glycine molecules adsorb in two different azimuthal orientations, which are associated with adsorption sites on the {110} and {311} microfacets of Cu{531}. Both types of adsorption sites allow a triangular footprint with surface bonds through the two oxygen atoms and the nitrogen atom. The occupation of the two adsorption sites is equal for all coverages, which can be explained by pair formation due to similar site-specific adsorption energies and the possibility of forming hydrogen bonds between molecules on adjacent {110} and {311} sites. This is not the ease for alanine and points toward higher site specificity in the case of alanine, which is eventually responsible for the enantiomeric differences observed for the alanine system.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Gallaborane (GaBH6, 1), synthesized by the metathesis of LiBH4 with [H2GaCl]n at ca. 250 K, has been characterized by chemical analysis and by its IR and 1H and 11B NMR spectra. The IR spectrum of the vapor at low pressure implies the presence of only one species, viz. H2Ga(μ-H)2BH2, with a diborane-like structure conforming to C2v symmetry. The structure of this molecule has been determined by gas-phase electron diffraction (GED) measurements afforced by the results of ab initio molecular orbital calculations. Hence the principal distances (rα in Å) and angles ( α in deg) are as follows: r(Ga•••B), 2.197(3); r(Ga−Ht), 1.555(6); r(Ga−Hb), 1.800(6); r(B−Ht), 1.189(7); r(B−Hb), 1.286(7); Hb−Ga−Hb, 71.6(4); and Hb−B−Hb, 110.0(5) (t = terminal, b = bridging). Aggregation of the molecules occurs in the condensed phases. X-ray crystallographic studies of a single crystal at 110 K reveal a polymeric network with helical chains made up of alternating pseudotetrahedral GaH4 and BH4 units linked through single hydrogen bridges; the average Ga•••B distance is now 2.473(7) Å. The compound decomposes in the condensed phases at temperatures exceeding ca. 240 K with the formation of elemental Ga and H2 and B2H6. The reactions with NH3, Me3N, and Me3P are also described.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The yncE gene of Escherichia coli encodes a predicted periplasmic protein of unknown function. The gene is de-repressed under iron restriction through the action of the global iron regulator Fur. This suggests a role in iron acquisition, which is supported by the presence of the adjacent yncD gene encoding a potential TonB-dependent outer-membrane transporter. Here, the preliminary crystallographic structure of YncE is reported, revealing that it consists of a seven-bladed beta-propeller which resembles the corresponding domain of the `surface-layer protein' of Methanosarcina mazei. A full structure determination is under way in order to provide insight into the function of this protein.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

YcdB is a periplasmic haem-containing protein from Escherichia coli that has a potential role in iron transport. It is currently the only reported haem-containing Tat-secreted substrate. Here, the overexpression, purification, crystallization and structure determination at 2.0 angstrom resolution are reported for the apo form of the protein. The apo-YcdB structure resembles those of members of the haem-dependent peroxidase family and thus confirms that YcdB is also a member of this family. Haem-soaking experiments with preformed apo-YcdB crystals have been optimized to successfully generate haem-containing YcdB crystals that diffract to 2.9 angstrom. Completion of model building and structure refinement are under way.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Analysis of X-ray powder data for the melt-crystallisable aromatic poly(thioether thioether ketone) [-S-Ar-S-Ar-CO-Ar](n), ('PTTK', Ar= 1,4-phenylene), reveals that it adopts a crystal structure very different from that established for its ether-analogue PEEK. Molecular modelling and diffraction-simulation studies of PTTK show that the structure of this polymer is analogous to that of melt-crystallised poly(thioetherketone) [-SAr-CO-Ar](n) in which the carbonyl linkages in symmetry-related chains are aligned anti-parallel to one another. and that these bridging units are crystallographically interchangeable. The final model for the crystal structure of PTTK is thus disordered, in the monoclinic space group 121a (two chains per unit cell), with cell dimensions a = 7.83, b = 6.06, c = 10.35 angstrom, beta = 93.47 degrees. (c) 2005 Elsevier Ltd. All rights reserved.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Polycondensation of 2,6-dihydroxynaphthalene with 4,4'-bis(4"-fluorobenzoyl)biphenyl affords a novel, semicrystalline poly(ether ketone) with a melting point of 406 degreesC and glass transition temperature (onset) of 168 degreesC. Molecular modeling and diffraction-simulation studies of this polymer, coupled with data from the single-crystal structure of an oligomer model, have enabled the crystal and molecular structure of the polymer to be determined from X-ray powder data. This structure-the first for any naphthalene-containing poly(ether ketone)-is fully ordered, in monoclinic space group P2(1)/b, with two chains per unit cell. Rietveld refinement against the experimental powder data gave a final agreement factor (R-wp) of 6.7%.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

In the past two decades, the geometric pathways involved in the transformations between inverse bicontinuous cubic phases in amphiphilic systems have been extensively theoretically modeled. However, little experimental data exists on the cubic-cubic transformation in pure lipid systems. We have used pressure-jump time-resolved X-ray diffraction to investigate the transition between the gyroid Q(II)(G) and double-diamond Q(II)(D) phases in mixtures of 1-monoolein in 30 wt% water. We find for this system that the cubic-cubic transition occurs without any detectable intermediate structures. In addition, we have determined the kinetics of the transition, in both the forward and reverse directions, as a function of pressure-jump amplitude, temperature, and water content. A recently developed model allows (at least in principle) the calculation of the activation energy for lipid phase transitions from such data. The analysis is applicable only if kinetic reproducibility is achieved, at least within one sample, and achievement of such kinetic reproducibility is shown here, by carrying out prolonged pressure-cycling. The rate of transformation shows clear and consistent trends with pressure-jump amplitude, temperature, and water content, all of which are shown to be in agreement with the effect of the shift in the position of the cubic-cubic phase boundary following a change in the thermodynamic parameters.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The compounds chlorothiazide and hydrochlorothiazide (crystalline form II) have been studied in their fully hydrogenous forms by powder neutron diffraction on the GEM diffractometer. The results of joint Rietveld refinement of the structures against multi-bank neutron and single-bank X-ray powder data are reported and show that accurate and precise structural information can be obtained from polycrystalline molecular organic materials by this route.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The structure of single wall peptide nanotubes is presented for the model surfactant-like peptide A6K. Capillary flow alignment of a sample in the nematic phase at high concentration in water leads to oriented X-ray diffraction patterns. Analysis of these, accompanied by molecular dynamics simulations, suggests the favourable self-assembly of antiparallel peptide dimers into beta-sheet ribbons that wrap helically to form the nanotube wall.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

YqjH is a cytoplasmic FAD-containing protein from Escherichia coli; based on homology to ViuB of Vibrio cholerae, it potentially acts as a ferri-siderophore reductase. This work describes its overexpression, purification, crystallization and structure solution at 3.0 A resolution. YqjH shares high sequence similarity with a number of known siderophore-interacting proteins and its structure was solved by molecular replacement using the siderophore-interacting protein from Shewanella putrefaciens as the search model. The YqjH structure resembles those of other members of the NAD(P)H:flavin oxidoreductase superfamily.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Pre-term birth is the leading cause of perinatal and neonatal mortality, 40% of which are attributed to the pre-term premature rupture of amnion. Rupture of amnion is thought to be associated with a corresponding decrease in the extracellular collagen content and/or increase in collagenase activity. However, there is very little information concerning the detailed organisation of fibrillar collagen in amnion and how this might influence rupture. Here we identify a loss of lattice like arrangement in collagen organisation from areas near to the rupture site, and present a 9% increase in fibril spacing and a 50% decrease in fibrillar organisation using quantitative measurements gained by transmission electron microscopy and the novel application of synchrotron X-ray diffraction. These data provide an accurate insight into the biomechanical process of amnion rupture and highlight X-ray diffraction as a new and powerful tool in our understanding of this process.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The complex [(C(NH2)3)3ZrOH(CO3)3·H2O]2 (A) has been shown by means of a single crystal X-ray diffraction study to contain [C(NH2)3]+ cations and dimeric anions of formulation [(ZrOH(CO3)3)2]6−. The anion is centrosymmetric with each metal being bonded to two bridging OH groups and three chelating CO2−3 ions. The Zr atoms are thus eight coordinate with a dodecahedral environments. The ZrO distances formed by the bridgng OH groups are shorter than those formed through zirconiu carbonate interactions. The non-bonded Zr…Zr distance is 3.47(2) Å. An infrared spectroscopic investigation of A provides data which support the findings of the crystallographic study. Likewise the complex Na6(ZrOH(CO2O4)3)2·7H2O (B) contains the anion [(ZrOH(C2O4)3)2]6−. This anion is structurally related to the anion in A as each Zr atom has an eight-coordinate dodecahedral environment being bonded to two bridging OH groups and three chelating oxalate ligands, but has no imposed crysallographic symmetry. The Zr…Zr non-bonded distance is 3.50(1) Å. The OZrO bridge angles are 69.7(4)° and A and 67.4(3)° in B.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Base catalysed reaction of the tricyclic ketone (6 ⇌ 7) with methylvinyl ketone gave the tetracyclic ketols, 11, 13, 15, 16, and the pentacyclic ketols, 12, 17. With phenylvinyl ketone, the tetracyclic ketol (18) was formed. The stereostructures of the ketols were identified by X-Ray diffraction. The base-catalysed title reactions gave the cyclic ketols and derived compounds shown below whose structures were identified by X-ray diffraction.