43 resultados para combined heat and power
em CentAUR: Central Archive University of Reading - UK
Resumo:
Biomass is an important source of energy in Thailand and is currently the main renewable energy source, accounting for 40% of the renewable energy used. The Department of Alternative Energy and E�ciency (DEDE), Ministry of Thailand, has been promoting the use of renewable energy in Thailand for the past decade. The new target for renewable energy usage in the country is set at 25% of the �nal energy demand in 2021. Thailand is the world’s fourth largest producer of cassava and this results in the production of signi�cant amounts of cassava rhizome which is a waste product. Cassava rhizome has the potential to be co-�red with coal for the production of heat and power. With suitable co-�ring ratios, little modi�cation will be required in the co-�ring technology. This review article is concerned with an investigation of the feasibility of co-�ring cassava rhizome in a combined heat and power system for a cassava based bio-ethanol plant in Thailand. Enhanced use of cassava rhizome for heat and power production could potentially contribute to a reduction of greenhouse gas emissions and costs, and would help the country to meet the 2021 renewable energy target.
Resumo:
Commercially supplied chicken breast muscle was subjected to simultaneous heat and pressure treatments. Treatment conditions ranged from ambient temperature to 70 °C and from 0.1 to 800 MPa, respectively, in various combinations. Texture profile analysis (TPA) of the treated samples was performed to determine changes in muscle hardness. At treatment temperatures up to and including 50 °C, heat and pressure acted synergistically to increase muscle hardness. However, at 60 and 70 °C, hardness decreased following treatments in excess of 200 MPa. TPA was performed on extracted myofibrillar protein gels that after treatment under similar conditions revealed similar effects of heat and pressure. Differential scanning calorimetry analysis of whole muscle samples revealed that at ambient pressure the unfolding of myosin was completed at 60 °C, unlike actin, which completely denatured only above 70 °C. With simultaneous pressure treatment at >200 MPa, myosin and actin unfolded at 20 °C. Unfolding of myosin and actin could be induced in extracted myofibrillar protein with simultaneous treatment at 200 MPa and 40 °C. Electrophoretic analysis indicated high pressure/temperature regimens induced disulfide bonding between myosin chains.
Resumo:
Almost all the electricity currently produced in the UK is generated as part of a centralised power system designed around large fossil fuel or nuclear power stations. This power system is robust and reliable but the efficiency of power generation is low, resulting in large quantities of waste heat. The principal aim of this paper is to investigate an alternative concept: the energy production by small scale generators in close proximity to the energy users, integrated into microgrids. Microgrids—de-centralised electricity generation combined with on-site production of heat—bear the promise of substantial environmental benefits, brought about by a higher energy efficiency and by facilitating the integration of renewable sources such as photovoltaic arrays or wind turbines. By virtue of good match between generation and load, microgrids have a low impact on the electricity network, despite a potentially significant level of generation by intermittent energy sources. The paper discusses the technical and economic issues associated with this novel concept, giving an overview of the generator technologies, the current regulatory framework in the UK, and the barriers that have to be overcome if microgrids are to make a major contribution to the UK energy supply. The focus of this study is a microgrid of domestic users powered by small Combined Heat and Power generators and photovoltaics. Focusing on the energy balance between the generation and load, it is found that the optimum combination of the generators in the microgrid- consisting of around 1.4 kWp PV array per household and 45% household ownership of micro-CHP generators- will maintain energy balance on a yearly basis if supplemented by energy storage of 2.7 kWh per household. We find that there is no fundamental technological reason why microgrids cannot contribute an appreciable part of the UK energy demand. Indeed, an estimate of cost indicates that the microgrids considered in this study would supply electricity at a cost comparable with the present electricity supply if the current support mechanisms for photovoltaics were maintained. Combining photovoltaics and micro-CHP and a small battery requirement gives a microgrid that is independent of the national electricity network. In the short term, this has particular benefits for remote communities but more wide-ranging possibilities open up in the medium to long term. Microgrids could meet the need to replace current generation nuclear and coal fired power stations, greatly reducing the demand on the transmission and distribution network.
Resumo:
Measured process data normally contain inaccuracies because the measurements are obtained using imperfect instruments. As well as random errors one can expect systematic bias caused by miscalibrated instruments or outliers caused by process peaks such as sudden power fluctuations. Data reconciliation is the adjustment of a set of process data based on a model of the process so that the derived estimates conform to natural laws. In this paper, techniques for the detection and identification of both systematic bias and outliers in dynamic process data are presented. A novel technique for the detection and identification of systematic bias is formulated and presented. The problem of detection, identification and elimination of outliers is also treated using a modified version of a previously available clustering technique. These techniques are also combined to provide a global dynamic data reconciliation (DDR) strategy. The algorithms presented are tested in isolation and in combination using dynamic simulations of two continuous stirred tank reactors (CSTR).
Resumo:
Time-resolved kinetic studies of the reaction of silylene, SiH2, with H2O and with D2O have been carried out in the gas phase at 297 K and at 345 K, using laser flash photolysis to generate and monitor SiH2. The reaction was studied independently as a function of H2O (or D2O) and SF6 (bath gas) pressures. At a fixed pressure of SF6 (5 Torr), [SiH2] decay constants, k(obs), showed a quadratic dependence on [H2O] or [D2O]. At a fixed pressure of H2O or D2O, k(obs) Values were strongly dependent on [SF6]. The combined rate expression is consistent with a mechanism involving the reversible formation of a vibrationally excited zwitterionic donor-acceptor complex, H2Si...OH2 (or H2Si...OD2). This complex can then either be stabilized by SF6 or it reacts with a further molecule of H2O (or D2O) in the rate-determining step. Isotope effects are in the range 1.0-1.5 and are broadly consistent with this mechanism. The mechanism is further supported by RRKM theory, which shows the association reaction to be close to its third-order region of pressure (SF6) dependence. Ab initio quantum calculations, carried out at the G3 level, support the existence of a hydrated zwitterion H2Si...(OH2)(2), which can rearrange to hydrated silanol, with an energy barrier below the reaction energy threshold. This is the first example of a gas-phase-catalyzed silylene reaction.
Resumo:
The phase diagram of cyclopentane has been studied by powder neutron diffraction, providing diffraction patterns for phases I, II, and III, over a range of temperatures and pressures. The putative phase IV was not observed. The structure of the ordered phase III has been solved by single-crystal diffraction. Computational modeling reveals that there are many equienergetic ordered structures for cyclopentane within a small energy range. Molecular dynamics simulations reproduce the structures and diffraction patterns for phases I and III and also show an intermediate disordered phase, which is used to interpret phase II.
Resumo:
Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.
Resumo:
The structure of the chiral kinked Pt{531} surface has been determined by low-energy electron diffraction intensity-versus-energy (LEED-IV) analysis and density functional theory (DFT). Large contractions and expansions of the vertical interlayer distances with respect to the bulk-terminated surface geometry were found for the first six layers (LEED: d(12) = 0.44 angstrom, d(23) = 0.69 angstrom, d(34) = 0.49 angstrom, d(45) = 0.95 angstrom, d(56) = 0.56 angstrom; DFT: d(12) = 0.51 angstrom, d(23) = 0.55 angstrom, d(34) = 0.74 angstrom, d(45) = 0.78 angstrom, d(56) = 0.63 angstrom; d(bulk) = 0.66 angstrom). Energy-dependent cancellations of LEED spots over unusually large energy ranges, up to 100 eV, can be explained by surface roughness and reproduced by applying a model involving 0.25 ML of vacancies and adatoms in the scattering calculations. The agreement between the results from LEED and DFT is not as good as in other cases, which could be due to this roughness of the real surface.
Resumo:
This contribution proposes a powerful technique for two-class imbalanced classification problems by combining the synthetic minority over-sampling technique (SMOTE) and the particle swarm optimisation (PSO) aided radial basis function (RBF) classifier. In order to enhance the significance of the small and specific region belonging to the positive class in the decision region, the SMOTE is applied to generate synthetic instances for the positive class to balance the training data set. Based on the over-sampled training data, the RBF classifier is constructed by applying the orthogonal forward selection procedure, in which the classifier's structure and the parameters of RBF kernels are determined using a PSO algorithm based on the criterion of minimising the leave-one-out misclassification rate. The experimental results obtained on a simulated imbalanced data set and three real imbalanced data sets are presented to demonstrate the effectiveness of our proposed algorithm.