Mixed culture fermentation studies on the effects of synbiotics on the human intestinal pathogens Campylobacter jejuni and Escherichia coli

Batch and continuous culture anaerobic fermentation systems, inoculated with human faeces, were utilised to investigate the antimicrobial actions of two probiotics, Lactobacillus plantartan 0407, combined with oligofructose and Bifidobacterium bifidum Bb12, combined with a mixture of oligofructose and xylo-oligosaccharides (50:50 w/w) against E coli and Campylobacter jejuni. In batch fermenters, both E coli and C jejuni were inhibited by the synbiotics, even when the culture pH was maintained at around neutral. In continuous culture C jejuni was inhibited but the synbiotic failed to inhibit E coli. Although no definitive answer in addressing the mechanisms underlying antimicrobial activity was derived, results suggested that acetate and lactate directly were conferring antagonistic action, rather than as a result of lowering culture pH. In the course of the study culturing and fluorescent in situ hybridisation (FISH) methodologies for the enumeration of bacterial populations were compared. Bifidobacterial populations were underestimated using plating techniques, suggesting the non-culturability of certain bifidobacterial species. (C) 2003 Elsevier Ltd. All rights reserved.

Mixed culture fermentation studies on the effects of synbiotics on the human intestinal pathogens Campylobacter jejuni and Escherichia coli

Batch and continuous culture anaerobic fermentation systems, inoculated with human faeces, were utilised to investigate the antimicrobial actions of two probiotics, Lactobacillus plantartan 0407, combined with oligofructose and Bifidobacterium bifidum Bb12, combined with a mixture of oligofructose and xylo-oligosaccharides (50:50 w/w) against E coli and Campylobacter jejuni. In batch fermenters, both E coli and C jejuni were inhibited by the synbiotics, even when the culture pH was maintained at around neutral. In continuous culture C jejuni was inhibited but the synbiotic failed to inhibit E coli. Although no definitive answer in addressing the mechanisms underlying antimicrobial activity was derived, results suggested that acetate and lactate directly were conferring antagonistic action, rather than as a result of lowering culture pH. In the course of the study culturing and fluorescent in situ hybridisation (FISH) methodologies for the enumeration of bacterial populations were compared. Bifidobacterial populations were underestimated using plating techniques, suggesting the non-culturability of certain bifidobacterial species. (C) 2003 Elsevier Ltd. All rights reserved.

Synthesis, reactivity, and X-ray crystal structure of some mixed-ligand oxovanadium(V) complexes: first report of binuclear oxovanadium(V) complexes containing 4,4 '-Bipyridine type bridge

Reaction of the tridentate ONO Schiff-base ligand 2-hydroxybenzoylhydrazone of 2-hydroxybenzoylhydrazine (H2L) with VO(acac)(2) in ethanol medium produces the oxoethoxovanadium(V) complex [VO(OEt)L] (A), which reacts with pyridine to form [VO(OEt)L center dot(py)] (1). Complex 1 is structurally characterized. It has a distorted octahedral O4N2 coordination environment around the V(V) acceptor center. Both complexes A and 1 in ethanol medium react with neutral monodentate Lewis bases 2-picoline, 3-picoline, 4-picoline, 4-amino pyridine, imidazole, and 4-methyl imidazole, all of which are stronger bases than pyridine, to produce dioxovanadium(V) complexes of general formula BH[VO2L]. Most of these dioxo complexes are structurally characterized, and the complex anion [VO2L](-) is found to possess a distorted square pyramidal structure. When a solution/suspension of a BH[VO2L] complex in an alcohol (ROH) is treated with HCl in the same alcohol, it is converted into the corresponding monooxoalkoxo complex [ O(OR)L], where R comes from the alcohol used as the reaction medium. Both complexes A and 1 produce the 4,4'-bipyridine-bridged binuclear complex [VO(OEt)L](2)(mu-4,4'-bipy) (2), which, to the best of our knowledge, represents the first report of a structurally characterized 4,4'-bipyridine-bridged oxovanadium(V) binuclear complex. Two similar binuclear oxovanadium(V) complexes 3 and 4 are also synthesized and characterized. All these binuclear complexes (2-4), on treatment with base B, produce the corresponding mononuclear dioxovanadium(V) complexes (5-10).

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Characterization and identification of mixed-metal phosphates in soils: the application, of Raman spectroscopy

The development of protocols for the identification of metal phosphates in phosphate-treated, metal-contaminated soils is a necessary yet problematical step in the validation of remediation schemes involving immobilization of metals as phosphate phases. The potential for Raman spectroscopy to be applied to the identification of these phosphates in soils has yet to be fully explored. With this in mind, a range of synthetic mixed-metal hydroxylapatites has been characterized and added to soils at known concentrations for analysis using both bulk X-ray powder diffraction (XRD) and Raman spectroscopy. Mixed-metal hydroxylapatites in the binary series Ca-Cd, Ca-Pb, Ca-Sr and Cd-Pb synthesized in the presence of acetate and carbonate ions, were characterized using a range of analytical techniques including XRD, analytical scanning electron microscopy (SEM), infrared spectroscopy (IR), inductively coupled plasma-atomic emission spectrometry (ICP-AES) and Raman spectroscopy. Only the Ca-Cd series displays complete solid solution, although under the synthesis conditions of this study the Cd-5(PO4)(3)OH end member could not be synthesized as a pure phase. Within the Ca-Cd series the cell parameters, IR active modes and Raman active bands vary linearly as a function of Cd content. X-ray diffraction and extended X-ray absorption fine structure spectroscopy (EXAFS) suggest that the Cd is distributed across both the Ca(1) and Ca(2) sites, even at low Cd concentrations. In order to explore the likely detection limits for mixed-metal phosphates in soils for XRD and Raman spectroscopy, soils doped with mixed-metal hydroxylapatites at concentrations of 5, 1 and 0.5 wt.% were then studied. X-ray diffraction could not confirm unambiguously the presence or identity of mixed-metal phosphates in soils at concentrations below 5 wt.%. Raman spectroscopy proved a far more sensitive method for the identification of mixed-metal hydroxylapatites in soils, which could positively identify the presence of such phases in soils at all the dopant concentrations used in this study. Moreover, Raman spectroscopy could also provide an accurate assessment of the degree of chemical substitution in the hydroxylapatites even when present in soils at concentrations as low as 0.1%.

Doppler lidar measurements of oriented planar ice crystals falling from supercooled and glaciated layer clouds

The properties of planar ice crystals settling horizontally have been investigated using a vertically pointing Doppler lidar. Strong specular reflections were observed from their oriented basal facets, identified by comparison with a second lidar pointing 4° from zenith. Analysis of 17 months of continuous high-resolution observations reveals that these pristine crystals are frequently observed in ice falling from mid-level mixed-phase layer clouds (85% of the time for layers at −15 °C). Detailed analysis of a case study indicates that the crystals are nucleated and grow rapidly within the supercooled layer, then fall out, forming well-defined layers of specular reflection. From the lidar alone the fraction of oriented crystals cannot be quantified, but polarimetric radar measurements confirmed that a substantial fraction of the crystal population was well oriented. As the crystals fall into subsaturated air, specular reflection is observed to switch off as the crystal faces become rounded and lose their faceted structure. Specular reflection in ice falling from supercooled layers colder than −22 °C was also observed, but this was much less pronounced than at warmer temperatures: we suggest that in cold clouds it is the small droplets in the distribution that freeze into plates and produce specular reflection, whilst larger droplets freeze into complex polycrystals. The lidar Doppler measurements show that typical fall speeds for the oriented crystals are ≈ 0.3 m s−1, with a weak temperature correlation; the corresponding Reynolds number is Re ∼ 10, in agreement with light-pillar measurements. Coincident Doppler radar observations show no correlation between the specular enhancement and the eddy dissipation rate, indicating that turbulence does not control crystal orientation in these clouds. Copyright © 2010 Royal Meteorological Society

Barley oxalate oxidase is a hexameric protein related to seed storage proteins: evidence from X-ray crystallography

The oxalate oxidase enzyme expressed in barley roots is a thermostable, protease-resistant enzyme that generates H2O2. It has great medical importance because of its use to assay plasma and urinary oxalate, and it has also been used to generate transgenic, pathogen-resistant crops. This protein has now been purified and three types of crystals grown. X-ray analysis shows that the symmetry present in these crystals is consistent with a hexameric arrangement of subunits, probably a trimer of dimers. This structure may be similar to that found in the related seed storage proteins.

Preliminary X-ray diffraction analysis of YcdB from Escherichia coli: a novel haem-containing and Tat-secreted periplasmic protein with a potential role in iron transport

YcdB is a periplasmic haem-containing protein from Escherichia coli that has a potential role in iron transport. It is currently the only reported haem-containing Tat-secreted substrate. Here, the overexpression, purification, crystallization and structure determination at 2.0 angstrom resolution are reported for the apo form of the protein. The apo-YcdB structure resembles those of members of the haem-dependent peroxidase family and thus confirms that YcdB is also a member of this family. Haem-soaking experiments with preformed apo-YcdB crystals have been optimized to successfully generate haem-containing YcdB crystals that diffract to 2.9 angstrom. Completion of model building and structure refinement are under way.

Structural and equilibrium studies on mixed ligand complexes of Co(II), Ni(II), Cu(II) and Zn(II) with N-(2-benzimidazolyl)methyliminodiacetic acid and typical N,N donor ligands

Mixed ligand complexes: [Co(L)(bipy)] (.) 3H(2)O (1), [Ni(L)(phen)] (.) H2O (2), [Cu(L)(phen)] (.) 3H(2)O (3) and [Zn(L)(bipy)] (.) 3H(2)O (4), where L2- = two -COOH deprotonated dianion of N-(2-benzimidazolyl)methyliminodiacetic acid (H(2)bzimida, hereafter, H,L), bipy = 2,2' bipyridine and phen = 1,10-phenanthroline have been isolated and characterized by elemental analysis, spectral and magnetic measurements and thermal studies. Single crystal X-ray diffraction studies show octahedral geometry for 1, 2 and 4 and square pyramidal geometry for 3. Equilibrium studies in aqueous solution (ionic strength I = 10(-1) mol dm(-3) (NaNO3), at 25 +/- 1 degrees C) using different molar proportions of M(II):H2L:B, where M = Co, Ni, Cu and Zn and B = phen, bipy and en (ethylene diamine), however, provides evidence of formation of mononuclear and binuclear binary and mixed ligand complexes: M(L), M(H-1L)(-), M(B)(2+), M(L)(B), M(H-1L)(B)(-), M-2(H-1L)(OH), (B)M(H-1L)M(B)(+), where H-1L3- represents two -COOH and the benzimidazole NI-H deprotonated quadridentate (O-, N, O-, N), or, quinquedentate (O-, N, O-, N, N-) function of the coordinated ligand H,L. Binuclear mixed ligand complex formation equilibria: M(L)(B) + M(B)(2+) = (B)M(H-1L)M(B)(+) + H+ is favoured with higher pi-acidity of the B ligands. For Co(II), Ni(II) and Cu(II), these equilibria are accompanied by blue shift of the electronic absorption maxima of M(II) ions, as a negatively charged bridging benzimidazolate moiety provides stronger ligand field than a neutral one. Solution stability of the mixed ligand complexes are in the expected order: Co(II) < Ni(II) < Cu(II) > Zn(II). The Delta logK(M) values are less negetive than their statistical values, indicating favoured formation of the mixed ligand complexes over the binary ones. (c) 2005 Elsevier B.V. All rights reserved.

Equilibrium studies on mixed ligand complex formation of Co(II), Ni(II), Cu(II) and Zn(II) with N-(2-hydroxybenzyl)-L-histidine (H(2)hb-L-his) and typical N,N donor ligands: Crystal structure of [Ni(hb-L-his)(bipyridine)]center dot H2O complex

Equilibrium study on complex formation of Co(II), Ni(II), Cu(II) and Zn(II), hereafter M(II), with the quadridentate (O-, N, O-, N) donor ligand, N-(2-hydroxybenzyl)-L-histidine (H(2)hb-L-his, hereafter H2L), in the absence and in the presence of typical (N, N) donor bidentate ligands, 1,10 phenanthroline(phen), 2, 2'-bipyridine(bipy), ethylenediamine(en), hereafter B, in aqueous solution at 25 +/- 1 degrees C was done at a fixed ionic strength, I = 0.1 mol dm(-3) (NaNO3) by combined pH-metric, UV-Vis and EPR measurements provide evidence for the formation of mononuclear and dinuclear binary and mixed ligand complexes of the types: M(L), M(L)(2)(2-), M-2(L)(2+), M-2(H-1L)(+), M(L)(B), (B)M(H-1L)M(B)(+). The imidazole moiety of the ligand is found to act as a bridging bidentate ligand in the dinuclear M-2(L)(2+), M-2(H-1L)(+) and (B)M(H-1L)M(B)(+) complexes, using its N-3 atom and N1-H deprotonated moiety. Stability constants of the complexes provide evidence of discrimination of Cu(II) from the other M(II) ions by this ligand. Solid complexes: [Ni(L)(H2O)(2)] (1), [Cu(L)(H2O)] (2), and [Ni(L)(bipy)] (.) H2O (3) have been isolated and characterized by various physicochemical studies. Single crystal X-ray diffraction of the ternary complex, 3, shows an octahedral [(O-,N,N,O-)(N,N)] geometry with extensive pi-pi stacking of the aromatic rings and H-bonding with imidazole (N1-H), secondary amino N-atom, the lattice H2O molecule, and the carboxylate and phenolate O-atoms. (c) 2006 Elsevier B.V. All rights reserved.

Construction of coordination polymers of cadmium(II) with mixed hexamethylenetetramine and terephthalate or thiocyanate ligands

Three new polymeric complexes [Cd(hmt)(SCN)(2)(H2O)(2)](n) (1), [Cd-3(mu(2)-hmt)(2)(SCN)(6)(H2O)(2)](n) (2), and [Cd-2(hmt)(2)(tP)(2)(H2O)(6)](n) (3) [hmt = hexamethylenetetramine, tp = terephthalate] have been synthesized and characterized by single crystal X-ray diffraction. Both the compounds 1 and 2 are 1-D polymers where Cd units are linked by double end-to-end thiocyanate bridges but in 2 the chain is wider containing three cadmium atoms instead of one as found in 1. In both compounds the coordination environment around cadmium atom is distorted octahedral. Compound 3 is a three-dimensional polymer having water-filled microporous channels. Both tp and brut are mu(2)-bridged. One of the acid groups of tp is coordinated in chelating bidentate and the other in monodentate fashion. Half of its Cd atoms are hexa-coordinated and the rest are hepta-coordinated. Thermogravimetric analysis and X-ray diffraction study of 3 show that its framework remains intact upon removal of water molecules. The flexibility of coordination number around cadmium atoms (six or seven) probably plays an important role in establishing the rigidity of the framework. (C) 2003 Elsevier Ltd. All rights reserved.

Bending, twisting, and breaking CuCN chains to produce framework materials: the reactions of CuCN with alkali-metal halides

The reactions of the low-temperature polymorph of copper(I) cyanide (LT-CuCN) with concentrated aqueous alkali-metal halide solutions have been investigated. At room temperature, KX (X = Br and I) and CsX (X = Cl, Br, and I) produce the addition products K[Cu-2(CN)(2)Br](H2O)-H-. (I), K-3[Cu-6(CN)(6)I-3](.)2H(2)O (II), Cs[Cu-3(CN)(3)Cl] (III), Cs[Cu-3(CN)(3)Br] (IV), and Cs-2[Cu-4(CN)(4)I-2](H2O)-H-. (V), with 3-D frameworks in which the -(CuCN)- chains present in CuCN persist. No reaction occurs, however, with NaX (X = Cl, Br, I) or KCl. The addition compounds, I-V, reconvert to CuCN when washed. Both low- and high-temperature polymorphs of CuCN (LT- and HT-CuCN) are produced, except in the case of Cs[Cu-3(CN)(3)Cl] (III), which converts only to LT-CuCN. Heating similar AX-CuCN reaction mixtures under hydrothermal conditions at 453 K for 1 day produces single crystals of I-V suitable for structure determination. Under these more forcing conditions, reactions also occur with NaX (X = Cl, Br, I) and KCl. NaBr and KCl cause some conversion of LT-CuCN into HT-CuCN, while NaCl and NaI, respectively, react to form the mixed-valence Cu(I)/Cu(II) compounds [Cu-II(OH2)(4)][Cu-4(I)(CN)(6)], a known phase, and [Cu-II(OH2)(4)][Cu-4(I)(CN)(4)I-2] (VI), a 3-D framework, which contains infinite -(CuCN)- chains. After 3 days of heating under hydrothermal conditions, the reaction between KI and CuCN produces [Cu-II(OH2)(4)][Cu-2(I)(CN)I-2](2) (VII), in which the CuCN chains are broken into single Cu-CN-Cu units, which in turn are linked into chains via iodine atoms and then into layers via long Cu-C and Cu-Cu interactions.

A hexadecanuclear copper(I)-copper(II) mixed-valence compound: structure, magnetic properties, intervalence charge transfer, EPR, and NMR

Hexadecanuclear copper mixed-valence complex 2 containing 10 Cu-II, centers and 6 Cu-I centers was isolated with N,O donor ligands. From the X-ray crystal structure, 2 was found to contain a centrosymmetric dimeric cation - each monomeric unit composed of eight copper centers. It displays a very broad and weak intervalence charge-transfer band around 1100 nm at room temperature in the solid state. Variable-temperature magnetic susceptibility measurements indicate an S = 1/2 ground state for half of 2, explicitly, each Cu-8 moiety has a g value around 2.26. Complex 2 was examined by NMR spectroscopy at room temperature in solution and by EPR at low temperature; the data indicates that the valence is delocalized in 2 at room temperature but localized at low temperature. ((C) Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, Germany, 2007)

Supramolecular helix and beta-sheet through self-assembly of two isomeric tetrapeptides in crystals and formation of filaments and ribbons in the solid state

Single crystal X-ray diffraction studies show that the beta-turn structure of tetrapeptide I, Boc-Gly-Phe-Aib-Leu-OMe (Aib: alpha-amino isobutyric acid) self-assembles to a supramolecular helix through intermolecular hydrogen bonding along the crystallographic a axis. By contrast the beta-turn structure of an isomeric tetrapeptide II, Boc-Gly-Leu-Aib-Phe-OMe self-assembles to a supramolecular beta-sheet-like structure via a two-dimensional (a, b axis) intermolecular hydrogen bonding network and pi-pi interactions. FT-IR studies of the peptides revealed that both of them form intermolecularly hydrogen bonded supramolecular structures in the solid state. Field emission scanning electron micrographs (FE-SEM) of the dried fibrous materials of the peptides show different morphologies, non-twisted filaments in case of peptide I and non-twisted filaments and ribbon-like structures in case of peptide II.