15 resultados para X-rays--Diffraction

em CentAUR: Central Archive University of Reading - UK


Relevância:

100.00% 100.00%

Publicador:

Resumo:

Gallaborane (GaBH6, 1), synthesized by the metathesis of LiBH4 with [H2GaCl]n at ca. 250 K, has been characterized by chemical analysis and by its IR and 1H and 11B NMR spectra. The IR spectrum of the vapor at low pressure implies the presence of only one species, viz. H2Ga(μ-H)2BH2, with a diborane-like structure conforming to C2v symmetry. The structure of this molecule has been determined by gas-phase electron diffraction (GED) measurements afforced by the results of ab initio molecular orbital calculations. Hence the principal distances (rα in Å) and angles ( α in deg) are as follows: r(Ga•••B), 2.197(3); r(Ga−Ht), 1.555(6); r(Ga−Hb), 1.800(6); r(B−Ht), 1.189(7); r(B−Hb), 1.286(7); Hb−Ga−Hb, 71.6(4); and Hb−B−Hb, 110.0(5) (t = terminal, b = bridging). Aggregation of the molecules occurs in the condensed phases. X-ray crystallographic studies of a single crystal at 110 K reveal a polymeric network with helical chains made up of alternating pseudotetrahedral GaH4 and BH4 units linked through single hydrogen bridges; the average Ga•••B distance is now 2.473(7) Å. The compound decomposes in the condensed phases at temperatures exceeding ca. 240 K with the formation of elemental Ga and H2 and B2H6. The reactions with NH3, Me3N, and Me3P are also described.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The yncE gene of Escherichia coli encodes a predicted periplasmic protein of unknown function. The gene is de-repressed under iron restriction through the action of the global iron regulator Fur. This suggests a role in iron acquisition, which is supported by the presence of the adjacent yncD gene encoding a potential TonB-dependent outer-membrane transporter. Here, the preliminary crystallographic structure of YncE is reported, revealing that it consists of a seven-bladed beta-propeller which resembles the corresponding domain of the `surface-layer protein' of Methanosarcina mazei. A full structure determination is under way in order to provide insight into the function of this protein.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

YcdB is a periplasmic haem-containing protein from Escherichia coli that has a potential role in iron transport. It is currently the only reported haem-containing Tat-secreted substrate. Here, the overexpression, purification, crystallization and structure determination at 2.0 angstrom resolution are reported for the apo form of the protein. The apo-YcdB structure resembles those of members of the haem-dependent peroxidase family and thus confirms that YcdB is also a member of this family. Haem-soaking experiments with preformed apo-YcdB crystals have been optimized to successfully generate haem-containing YcdB crystals that diffract to 2.9 angstrom. Completion of model building and structure refinement are under way.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

In the past two decades, the geometric pathways involved in the transformations between inverse bicontinuous cubic phases in amphiphilic systems have been extensively theoretically modeled. However, little experimental data exists on the cubic-cubic transformation in pure lipid systems. We have used pressure-jump time-resolved X-ray diffraction to investigate the transition between the gyroid Q(II)(G) and double-diamond Q(II)(D) phases in mixtures of 1-monoolein in 30 wt% water. We find for this system that the cubic-cubic transition occurs without any detectable intermediate structures. In addition, we have determined the kinetics of the transition, in both the forward and reverse directions, as a function of pressure-jump amplitude, temperature, and water content. A recently developed model allows (at least in principle) the calculation of the activation energy for lipid phase transitions from such data. The analysis is applicable only if kinetic reproducibility is achieved, at least within one sample, and achievement of such kinetic reproducibility is shown here, by carrying out prolonged pressure-cycling. The rate of transformation shows clear and consistent trends with pressure-jump amplitude, temperature, and water content, all of which are shown to be in agreement with the effect of the shift in the position of the cubic-cubic phase boundary following a change in the thermodynamic parameters.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The compounds chlorothiazide and hydrochlorothiazide (crystalline form II) have been studied in their fully hydrogenous forms by powder neutron diffraction on the GEM diffractometer. The results of joint Rietveld refinement of the structures against multi-bank neutron and single-bank X-ray powder data are reported and show that accurate and precise structural information can be obtained from polycrystalline molecular organic materials by this route.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The structure of single wall peptide nanotubes is presented for the model surfactant-like peptide A6K. Capillary flow alignment of a sample in the nematic phase at high concentration in water leads to oriented X-ray diffraction patterns. Analysis of these, accompanied by molecular dynamics simulations, suggests the favourable self-assembly of antiparallel peptide dimers into beta-sheet ribbons that wrap helically to form the nanotube wall.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

YqjH is a cytoplasmic FAD-containing protein from Escherichia coli; based on homology to ViuB of Vibrio cholerae, it potentially acts as a ferri-siderophore reductase. This work describes its overexpression, purification, crystallization and structure solution at 3.0 A resolution. YqjH shares high sequence similarity with a number of known siderophore-interacting proteins and its structure was solved by molecular replacement using the siderophore-interacting protein from Shewanella putrefaciens as the search model. The YqjH structure resembles those of other members of the NAD(P)H:flavin oxidoreductase superfamily.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Pre-term birth is the leading cause of perinatal and neonatal mortality, 40% of which are attributed to the pre-term premature rupture of amnion. Rupture of amnion is thought to be associated with a corresponding decrease in the extracellular collagen content and/or increase in collagenase activity. However, there is very little information concerning the detailed organisation of fibrillar collagen in amnion and how this might influence rupture. Here we identify a loss of lattice like arrangement in collagen organisation from areas near to the rupture site, and present a 9% increase in fibril spacing and a 50% decrease in fibrillar organisation using quantitative measurements gained by transmission electron microscopy and the novel application of synchrotron X-ray diffraction. These data provide an accurate insight into the biomechanical process of amnion rupture and highlight X-ray diffraction as a new and powerful tool in our understanding of this process.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The complex [(C(NH2)3)3ZrOH(CO3)3·H2O]2 (A) has been shown by means of a single crystal X-ray diffraction study to contain [C(NH2)3]+ cations and dimeric anions of formulation [(ZrOH(CO3)3)2]6−. The anion is centrosymmetric with each metal being bonded to two bridging OH groups and three chelating CO2−3 ions. The Zr atoms are thus eight coordinate with a dodecahedral environments. The ZrO distances formed by the bridgng OH groups are shorter than those formed through zirconiu carbonate interactions. The non-bonded Zr…Zr distance is 3.47(2) Å. An infrared spectroscopic investigation of A provides data which support the findings of the crystallographic study. Likewise the complex Na6(ZrOH(CO2O4)3)2·7H2O (B) contains the anion [(ZrOH(C2O4)3)2]6−. This anion is structurally related to the anion in A as each Zr atom has an eight-coordinate dodecahedral environment being bonded to two bridging OH groups and three chelating oxalate ligands, but has no imposed crysallographic symmetry. The Zr…Zr non-bonded distance is 3.50(1) Å. The OZrO bridge angles are 69.7(4)° and A and 67.4(3)° in B.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Base catalysed reaction of the tricyclic ketone (6 ⇌ 7) with methylvinyl ketone gave the tetracyclic ketols, 11, 13, 15, 16, and the pentacyclic ketols, 12, 17. With phenylvinyl ketone, the tetracyclic ketol (18) was formed. The stereostructures of the ketols were identified by X-Ray diffraction. The base-catalysed title reactions gave the cyclic ketols and derived compounds shown below whose structures were identified by X-ray diffraction.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

[Cu2(μO2CCH3)4(H2O)2], [CuCO3·Cu(OH)2], [CoSO4·7H2O], [Co((+)-tartrate)], and [FeSO4·7H2O] react with excess racemic (±)- 1,1′-binaphthyl-2,2′-diyl hydrogen phosphate {(±)-PhosH} to give mononuclear CuII, CoII and FeII products. The cobalt product, [Co(CH3OH)4(H2O)2]((+)-Phos)((−)-Phos) ·2CH3OH·H2O (7), has been identified by X-ray diffraction. The high-spin, octahedral CoII atom is ligated by four equatorial methanol molecules and two axial water molecules. A (+)- and a (−)-Phos− ion are associated with each molecule of the complex but are not coordinated to the metal centre. For the other CoII, CuII and FeII samples of similar formulation to (7) it is also thought that the Phos− ions are not bonded directly to the metal. When some of the CuII and CoII samples are heated under high vacuum there is evidence that the Phos− ions are coordinated directly to the metals in the products.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The X-ray diffraction pattern of glassy poly(2-hydroxypropyl ether of bisphenol A) is studied at room temperature on oriented samples in order to associate its different peaks to different structural correlations. On the other hand, X-ray diffraction patterns have been obtained at different temperatures from Tg − 50 K up to Tg + 50 K for the above-mentioned polymer. Attention has been paid to the evolution with temperature of the position of the wide diffraction maximum corresponding to interchain correlations in the polymer. The temperature evolution of this parameter shows a marked discontinuity just at the glass transition temperature.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Platinum is one of the most common coatings used to optimize mirror reflectivity in soft X-ray beamlines. Normal operation results in optics contamination by carbon-based molecules present in the residual vacuum of the beamlines. The reflectivity reduction induced by a carbon layer at the mirror surface is a major problem in synchrotron radiation sources. A time-dependent photoelectron spectroscopy study of the chemical reactions which take place at the Pt(111) surface under operating conditions is presented. It is shown that the carbon contamination layer growth can be stopped and reversed by low partial pressures of oxygen for optics operated in intense photon beams at liquidnitrogen temperature. For mirrors operated at room temperature the carbon contamination observed for equivalent partial pressures of CO is reduced and the effects of oxygen are observed on a long time scale.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

X-ray resonant scattering has been exploited to investigate the crystal structure of the AB1.5Te1.5 phases (A = Co, Rh, Ir; B = Ge, Sn). Analysis of the diffraction data reveals that CoGe1.5Te1.5 and ASn1.5Te1.5 adopt a rhombohedral skutterudite-related structure, containing diamond-shape B2Te2 rings, in which the B and Te atoms are ordered and trans to each other. Anion ordering is however incomplete, and with increasing the size of both cations and anions, the degree of anion ordering decreases. By contrast, the diffraction data of IrGe1.5Te1.5 are consistent with an almost statistical distribution of the anions over the available sites, although some ordered domains may be present. The thermoelectric properties of these materials are discussed in the light of these results.