50 resultados para Union of Basque Municipalities (UEMA)
em CentAUR: Central Archive University of Reading - UK
Resumo:
The chapter sets its analysis of the historical and contemporary detention of asylum seekers in Israel against a wider context of that country's national immigration policy. The chapter demonstrates that Israel perceives asylum seekers as a threat to its self-defined Jewish character. Its twofold conclusion argues that the government therefore subjects asylum seekers to harsh detention practices that afford detainees limited procedural guarantees, and that these procedures cut against the justification for detention as a measure to facilitate deportation.
Resumo:
The purpose of this paper is to show that, for a large class of band-dominated operators on $\ell^\infty(Z,U)$, with $U$ being a complex Banach space, the injectivity of all limit operators of $A$ already implies their invertibility and the uniform boundedness of their inverses. The latter property is known to be equivalent to the invertibility at infinity of $A$, which, on the other hand, is often equivalent to the Fredholmness of $A$. As a consequence, for operators $A$ in the Wiener algebra, we can characterize the essential spectrum of $A$ on $\ell^p(Z,U)$, regardless of $p\in[1,\infty]$, as the union of point spectra of its limit operators considered as acting on $\ell^p(Z,U)$.
Resumo:
Inductively coupled plasma mass spectrometry (ICP-MS) was used to investigate changes in trace element concentration in two high resolution sequences of tree rings from central Sweden. Individual annual growth increments from 18002002 to 1930-2002 were sampled from two Scots pine (Pinus sylvestris) trees from the Siljansfors Experimental Forest. The aims of the study were: to test the viability of conventional solution induction ICP-MS as a technique for investigating the multi-elemental chemistry of long tree ring sequences at annual resolution, and, to test this specifically with a view to detecting changes in elemental concentrations of Swedish tree rings contemporary with the major (and relatively proximal) Icelandic eruption of Askja (1875). It was found that despite a time consuming sample preparation process, it was possible to use conventional ICP-MS for multi-elemental analysis of a long sequence of tree rings at annual resolution. Although promising data were produced, no truly conclusive concentration anomaly could be detected in the sequence to indicate the impact of the Askja eruption on environmental chemistry. Overall findings underlined the complexity of the tree/environment interaction and the cautious approach to data interpretation essential for any dendrochemical study. (c) 2006 Elsevier Ltd. All rights reserved.
Resumo:
The International System of Units, the SI, is built upon seven base quantities and seven base units, as summarized in the table below. Although most of these are familiar to all scientists, the quantity “amount of substance” and its unit “mole” are less familiar and are mainly used by chemists.1 In the chemistry community, the unit “mole” is familiar, but the name of the corresponding quantity “amount of substance” is not so familiar, and the concept is still a source of difficulty for many students. This article reviews and clarifies these two concepts2 and discusses the definition of the unit “mole” and its possible revision.
Resumo:
The cupin superfamily of proteins is among the most functionally diverse of any described to date. It was named on the basis of the conserved beta-barrel fold ('cupa' is the Latin term for a small barrel), and comprises both enzymatic and non-enzymatic members, which have either one or two cupin domains. Within the conserved tertiary structure, the variety of biochemical function is provided by minor variation of the residues in the active site and the identity of the bound metal ion. This review discusses the advantages of this particular scaffold and provides an evolutionary analysis of 18 different subclasses within the cupin superfamily.
Resumo:
The title solvate, C7H8N4O2 center dot C2H6OS, was obtained unintentionally from a cocrystal screen involving theophylline and isophthalic acid. One molecule each of theophylline and dimethyl sulfoxide is present in the asymmetric unit. The packing consists of molecular sheets lying parallel to the ( 040) series of lattice planes, in which each theophylline molecule is hydrogen bonded to one dimethyl sulfoxide molecule through an N-H center dot center dot center dot O [2.7658 (15) angstrom] hydrogen bond. This particular hydrogen-bond donor was found to be used in this type of interaction in a variety of other crystal structures of theophylline.
Resumo:
Rolling Contact Fatigue (RCF) is one of the main issues that concern, at least initially, the head of the railway; progressively they can be of very high importance as they can propagate inside the material with the risk of damaging the railway. In this work, two different non-destructive techniques, infrared thermography (IRT) and fibre optics microscopy (FOM), were used in the inspection of railways for the tracing of defects and deterioration signs. In the first instance, two different approaches (dynamic and pulsed thermography) were used, whilst in the case of FOM, microscopic characterisation of the railway heads and classification of the deterioration -- damage on the railways according to the UIC (International Union of Railways) code, took place. Results from both techniques are presented and discussed.
Resumo:
Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.
Resumo:
A hitherto undescribed Actinomyces-like bacterium was isolated from the vagina of a dog. Biochemical testing and PAGE analysis of whole-cell proteins indicated that the isolate was phenotypically different from previously described Actinomyces species and related taxa. Sequencing of 165 rRNA showed that the unknown bacterium was distinct from all currently known Actinomyces species. Phylogenetically, the unidentified organism displayed a specific association with Actinomyces europaeus, but a sequence divergence of > 5% demonstrated that it represents a distinct species. Based on both phenotypic and 165 rRNA sequence considerations, it is proposed that the unknown strain from a dog be classified as a novel species, Actinomyces coleocanis sp. nov. The type strain is CCUG 41708T (= CIP 106873T).
Resumo:
A polyphasic taxonomic study was performed on a previously unidentified gram-positive, facultatively anaerobic, diphtheroid-shaped organism isolated from a vaginal discharge of a horse. Comparative 16S rRNA gene sequencing demonstrated that the strain was a member of the genus Arcanobacterium, but sequence divergence values of >4% with described species of this genus (viz: Arcanobacterium haemolyticum, Arcanobacterium bernardiae, Arcanobacterium phocae, Arcanobacterium pluranimalium and Arcanobacterium pyogenes) demonstrated that the isolate represented a novel species. The unknown bacterium was readily distinguished from other Arcanobacterium species by biochemical tests. Based on phylogenetic and phenotypic evidence, it is proposed that the unknown bacterium be classified as Arcanobacterium hippocoleae sp. nov. The type strain of A. hippocoleae is CCUG 44697T (= CIP 106850T).
Resumo:
YqjH is a cytoplasmic FAD-containing protein from Escherichia coli; based on homology to ViuB of Vibrio cholerae, it potentially acts as a ferri-siderophore reductase. This work describes its overexpression, purification, crystallization and structure solution at 3.0 A resolution. YqjH shares high sequence similarity with a number of known siderophore-interacting proteins and its structure was solved by molecular replacement using the siderophore-interacting protein from Shewanella putrefaciens as the search model. The YqjH structure resembles those of other members of the NAD(P)H:flavin oxidoreductase superfamily.
Resumo:
In its three recent rulings in the cases of Zambrano, McCarthy, and Dereci, the Court appears to have been determined to redefine the external boundaries of EU law, in cases involving the family reunification rights of Union citizens.These three judgments can be read as an indication that for Article 20 TFEU to apply, there is no longer a requirement of a cross-border element on the facts of the case, and that it is sufficient if the contested national measure has the effect of ‘depriving citizens of the Union of the genuine enjoyment of the substance’ of their rights (the ‘Zambrano principle’).The cases can, at the same time, also be read as a confirmation that the free movement provisions do – still – require a cross-border element and, in particular, the exercise of inter-State movement, in order to apply. Though the result in these cases has not been entirely unexpected, especially in the aftermath of the Rottmann ruling, it is rather problematic in that, although it is obvious that the Court wishes to redraw the line dividing the national and EU spheres of competence, it does not make it entirely clear where this line now lies and leaves many essential questions unanswered, which will obviously require some time to be resolved. EU lawyers are consequently, once more, left with having to decipher as best as they can the real intentions of the Court in this new line of case-law, which has been further complicated by the fact that what the Court seems to have given with one hand in Zambrano (and before that in Rottmann), has taken it back to a large extent through its rulings in McCarthy and Dereci, which appear to confine the former two cases to their own exceptional facts.6 Moreover, the ‘reverse discrimination Pandora’s box’, the opening of which appears to have been the real target of these references, remains untouched: instead of providing a direct solution to this problem, the Court has chosen to – once again – broaden the scope of the Treaty provisions in order to include within it as many situations as possible and, thus, prevent the emergence of this type of differential treatment on a case-by-case basis.As will be explained, nonetheless, this is by no means an appropriate solution to the reverse discrimination conundrum.
Resumo:
A straightforward procedure (assuming spherical symmetry) is described, which enables the unwanted small-angle component of the scattering for a finite model to be calculated. The method may be applied to models of any shape or size. It is illustrated by means of a single polymer chain.