81 resultados para Telomeric sequence

em CentAUR: Central Archive University of Reading - UK


Relevância:

60.00% 60.00%

Publicador:

Resumo:

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Relevância:

20.00% 20.00%

Publicador:

Relevância:

20.00% 20.00%

Publicador:

Resumo:

AtTRB1, 2 and 3 are members of the SMH (single Myb histone) protein family, which comprises double-stranded DNA-binding proteins that are specific to higher plants. They are structurally conserved, containing a Myb domain at the N-terminus, a central H1/H5-like domain and a C-terminally located coiled-coil domain. AtTRB1, 2 and 3 interact through their Myb domain specifically with telomeric double-stranded DNA in vitro, while the central H1/H5-like domain interacts non-specifically with DNA sequences and mediates protein–protein interactions. Here we show that AtTRB1, 2 and 3 preferentially localize to the nucleus and nucleolus during interphase. Both the central H1/H5-like domain and the Myb domain from AtTRB1 can direct a GFP fusion protein to the nucleus and nucleolus. AtTRB1–GFP localization is cell cycle-regulated, as the level of nuclear-associated GFP diminishes during mitotic entry and GFP progressively re-associates with chromatin during anaphase/telophase. Using fluorescence recovery after photobleaching and fluorescence loss in photobleaching, we determined the dynamics of AtTRB1 interactions in vivo. The results reveal that AtTRB1 interaction with chromatin is regulated at two levels at least, one of which is coupled with cell-cycle progression, with the other involving rapid exchange.

Relevância:

20.00% 20.00%

Publicador:

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In recent years, a large number of papers have reported the response of the cusp to solar wind variations under conditions of northward or southward Interplanetary Magnetic Field (IMF) Z-component (BZ). These studies have shown the importance of both temporal and spatial factors in determining the extent and morphology of the cusp and the changes in its location, connected to variations in the reconnection geometry. Here we present a comparative study of the cusp, focusing on an interval characterised by a series of rapid reversals in the BZ-dominated IMF, based on observations from space-borne and ground-based instrumentation. During this interval, from 08:00 to 12:00 UT on 12 February 2003, the IMF BZ component underwent four reversals, remaining for around 30 min in each orientation. The Cluster spacecraft were, at the time, on an outbound trajectory through the Northern Hemisphere magnetosphere, whilst the mainland VHF and Svalbard (ESR) radars of the EISCAT facility were operating in support of the Cluster mission. Both Cluster and the EISCAT were, on occasion during the interval, observing the cusp region. The series of IMF reversal resulted in a sequence of poleward and equatorward motions of the cusp; consequently Cluster crossed the high altitude cusp twice before finally exiting the dayside magnetopause, both times under conditions of northward IMF BZ. The first magnetospheric cusp encounter, by all four Cluster spacecraft, showed reverse ion dispersion typical of lobe reconnection; subsequently, Cluster spacecraft 1 and 3 (only) crossed the cusp for a second time. We suggest that, during this second cusp crossing, these two spacecraft were likely to have been on newly closed field lines, which were first reconnected (opened) at low latitudes and later reconnected again (re-closed) poleward of the northern cusp.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Monomer-sequence information in synthetic copolyimides can be recognised by tweezer-type molecules binding to adjacent triplet-sequences on the polymer chains. In the present paper different tweezer-molecules are found to have different sequence-selectivities, as demonstrated in solution by 1H NMR spectroscopy and in the solid state by single crystal X-ray analyses of tweezer-complexes with linear and macrocyclic oligo-imides. This work provides clear-cut confirmation of polyimide chain-folding and adjacent-tweezer-binding. It also reveals a new and entirely unexpected mechanism for sequence-recognition which, by analogy with a related process in biomolecular information processing, may be termed "frameshift-reading". The ability of one particular tweezer-molecule to detect, with exceptionally high sensitivity, long-range sequence-information in chain-folding aromatic copolyimides, is readily explained by this novel process.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Inversions breaking the 1041 bp int1h-1 or the 9.5-kb int22h-1 sequence of the F8 gene cause hemophilia A in 1/30,000 males. These inversions are due to homologous recombination between the above sequences and their inverted copies on the same DNA molecule, respectively, int1h-2 and int22h-2 or int22h-3. We find that (1) int1h and int22h duplicated more than 25 million years ago; (2) the identity of the copies (>99%) of these sequences in humans and other primates is due to gene conversion; (3) gene conversion is most frequent in the internal regions of int22h; (4) breakpoints of int22h-related inversions also tend to involve the internal regions of int22h; (5) sequence variations in a sample of human X chromosomes defined eight haplotypes of int22h-1 and 27 of int22h-2 plus int22h-3; (6) the latter two sequences, which lie, respectively, 500 and 600 kb telomeric to int22h-1 are five-fold more identical when in cis than when in trans, thus suggesting that gene conversion may be predominantly intrachromosomal; (7) int1h, int22h, and flanking sequences evolved at a rate of about 0.1% substitutions per million years during the divergence between humans and other primates, except for int1h during the human-chimpanzee divergence, when its rate of evolution was significantly lower. This is reminiscent of the slower evolution of palindrome arms in the male specific regions of the Y chromosome and we propose, as an explanation, that intrachromosomal gene conversion and cosegregation of the duplicated regions favors retention of the ancestral sequence and thus reduces the evolution rate.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The recently described cupin superfamily of proteins includes the germin and germinlike proteins, of which the cereal oxalate oxidase is the best characterized. This superfamily also includes seed storage proteins, in addition to several microbial enzymes and proteins with unknown function. All these proteins are characterized by the conservation of two central motifs, usually containing two or three histidine residues presumed to be involved with metal binding in the catalytic active site. The present study on the coding regions of Synechocystis PCC6803 identifies a previously unknown group of 12 related cupins, each containing the characteristic two-motif signature. This group comprises 11 single-domain proteins, ranging in length from 104 to 289 residues, and includes two phosphomannose isomerases and two epimerases involved in cell wall synthesis, a member of the pirin group of nuclear proteins, a possible transcriptional regulator, and a close relative-of a cytochrome c551 from Rhodococcus. Additionally, there is a duplicated, two-domain protein that has close similarity to an oxalate decarboxylase from the fungus Collybia velutipes and that is a putative progenitor of the storage proteins of land plants.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The order Fabales, including Leguminosae, Polygalaceae, Quillajaceae and Surianaceae, represents a novel hypothesis emerging from angiosperm molecular phylogenies. Despite good support for the order, molecular studies to date have suggested contradictory, poorly supported interfamilial relationships. Our reappraisal of relationships within Fabales addresses past taxon sampling deficiencies, and employs parsimony and Bayesian approaches using sequences from the plastid regions rbcL (166 spp.) and matK (78 spp.). Five alternative hypotheses for interfamilial relationships within Fabales were recovered. The Shimodaira-Hasegawa test found the likelihood of a resolved topology significantly higher than the one calculated for a polytomy, but did not favour any of the alternative hypotheses of relationship within Fabales. In the light of the morphological evidence available and the comparative behavior of rbcL and matK, the topology recovering Polygalaceae as sister to the rest of the order Fabales with Leguminosae more closely related to Quillajaceae + Surianaceae, is considered the most likely hypothesis of interfamilial relationships of the order. Dating of selected crown clades in the Fabales phylogeny using penalized likelihood suggests rapid radiation of the Leguminosae, Polygalaceae, and (Quillajaceae + Surianaceae) crown clades.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Diversity in the chloroplast genome of 171 accessions representing the Brassica 'C' (n = 9) genome, including domesticated and wild B. oleracea and nine inter-fertile related wild species, was investigated using six chloroplast SSR (microsatellite) markers. The lack of diversity detected among 105 cultivated and wild accessions of B. oleracea contrasted starkly with that found within its wild relatives. The vast majority of B. oleracea accessions shared a single haplotype, whereas as many as six haplotypes were detected in two wild species, B. villosa Biv. and B. cretica Lam.. The SSRs proved to be highly polymorphic across haplotypes, with calculated genetic diversity values (H) of 0.23-0.87. In total, 23 different haplotypes were detected in C genome species, with an additional five haplotypes detected in B. rapa L. (A genome n = 10) and another in B. nigra L. (B genome, n = 8). The low chloroplast diversity of B. oleracea is not suggestive of multiple domestication events. The predominant B. oleracea haplotype was also common in B. incana Ten. and present in low frequencies in B. villosa, B. macrocarpa Guss, B. rupestris Raf. and B. cretica. The chloroplast SSRs reveal a wealth of diversity within wild Brassica species that will facilitate further evolutionary and phylogeographic studies of this important crop genus.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Investigations were conducted during the 2003, 2004 and 2005 growing seasons in northern Greece to evaluate effects of tillage regime (mouldboard plough, chisel plough and rotary tiller), cropping sequence (continuous cotton, cotton-sugar beet rotation and continuous tobacco) and herbicide treatment on weed seedbank dynamics. Amaranthus spp. and Portulaca oleracea were the most abundant species, ranging from 76% to 89% of total weed seeds found in 0-15 and 15-30 cm soil depths during the 3 years. With the mouldboard plough, 48% and 52% of the weed seedbank was found in the 0-15 and 15-30 cm soil horizons, while approximately 60% was concentrated in the upper 15 cm soil horizon for chisel plough and rotary tillage. Mouldboard ploughing significantly buried more Echinochloa crus-galli seeds in the 15-30 cm soil horizon compared with the other tillage regimes. Total seedbank (0-30 cm) of P. oleracea was significantly reduced in cotton-sugar beet rotation compared with cotton and tobacco monocultures, while the opposite occurred for E. crus-galli. Total seed densities of most annual broad-leaved weed species (Amaranthus spp., P. oleracea, Solanum nigrum) and E. crus-galli were lower in herbicide treated than in untreated plots. The results suggest that in light textured soils, conventional tillage with herbicide use gradually reduces seed density of small seeded weed species in the top 15 cm over several years. In contrast, crop rotation with the early established sugar beet favours spring-germinating grass weed species, but also prevents establishment of summer-germinating weed species by the early developing crop canopy.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The monophyly of the Peltophorum group, one of nine informal groups recognized by Polhill in the Caesalpinieae, was tested using sequence data from the trnL-F, rbcL, and rps16 regions of the chloroplast genome. Exemplars were included from all 16 genera of the Peltophorum group, and from 15 genera representing seven of the other eight informal groups in the tribe. The data were analyzed separately and in combined analyses using parsimony and Bayesian methods. The analysis method had little effect on the topology of well-supported relationships. The molecular data recovered a generally well-supported phylogeny with many intergeneric relationships resolved. Results show that the Peltophorum group as currently delimited is polyphyletic, but that eight genera plus one undescribed genus form a core Peltophorum group, which is referred to here as the Peltophorum group sensu stricto. These genera are Bussea, Conzattia, Colvillea, Delonix, Heteroflorum (inedit.), Lemuropisum, Parkinsonia, Peltophorum, and Schizolobium. The remaining eight genera of the Peltophorum group s.l. are distributed across the Caesalpinieae. Morphological support for the redelimited Peltophorum group and the other recovered clades was assessed, and no unique synapomorphy was found for the Peltophorum group s.s. A proposal for the reclassification of the Peltophorum group s.l. is presented.