17 resultados para Single hard diffraction
em CentAUR: Central Archive University of Reading - UK
Resumo:
The phase diagram of cyclopentane has been studied by powder neutron diffraction, providing diffraction patterns for phases I, II, and III, over a range of temperatures and pressures. The putative phase IV was not observed. The structure of the ordered phase III has been solved by single-crystal diffraction. Computational modeling reveals that there are many equienergetic ordered structures for cyclopentane within a small energy range. Molecular dynamics simulations reproduce the structures and diffraction patterns for phases I and III and also show an intermediate disordered phase, which is used to interpret phase II.
Resumo:
A tetranuclear Cu(II) complex [Cu4L4(H2O)4](ClO4)4 has been synthesized using the terdentate Schiff base 2-(pyridine-2-yliminomethyl)-phenol (HL) (the condensation product of salicylaldehyde and 2-aminopyridine) and copper perchlorate. Chemical characterizations such as IR and UV/Vis of the complex have been carried out. A single-crystal diffraction study shows that the complex contains a nearly planar tetranuclear core containing four copper atoms, which occupy four equivalent five-coordinate sites with a square pyramidal environment. Magnetic measurements have been carried out over the temperature range 2–300K and with 100Oe field strengths. Analysis of magnetic susceptibility data indicates a strong antiferromagnetic (J1=−638cm−1) exchange interaction between diphenoxo-bridged Cu(II) centers and a moderate antiferromagnetic (J2=−34cm−1) interaction between N–C–N bridged Cu(II) centers. Magnetic exchange interactions (J’s) are also discussed on the basis of a computational study using DFT methodology. The spin density distribution (singlet ground state) is calculated to visualize the effect of delocalization of spin density through bridging groups.
Resumo:
An open-framework indium selenide, [C7H10N][In9Se14], has been prepared under solvothermal conditions in the presence of 3,5-dimethylpyridine, and characterized by single crystal diffraction, thermogravimetry, elemental analysis, FTIR spectroscopy and UV-Vis diffuse reflectance. The crystal structure of [C7H10N][In9Se14] contains an unusual building unit, in which corner-linked and edge-linked InSe45- tetrahedra coexist. The presence of one-dimensional circular channels, of ca. 6 Å diameter, results in approximately 25% of solvent accessible void space.
Resumo:
In situ generation of HCl or HBr in alcohol leads to O-protonation of the amide group of carbamazepine. Six salt phases have been produced using this method and their crystal structures determined by single crystal diffraction. A new polymorph of carbamazepine hydrochloride is described as are two polymorphs of carbamazepine hydrobromide. All are protonated at the amide O atom to give RC(OH)NH2 cations. Prolonged exposure to air results in addition of water to the solid salt forms. Such hydration of carbamazepine hydrobromide simply gives a monohydrated phase, but similar treatment of the equivalent hydrochloride results in partial loss of HCl and the transfer of the remaining proton from the amide group to water to give [carbamazepine][H3O]0.5[Cl]0.5·H2O. A similar hydronium chloride species is the only product isolated after reaction of the carbamazepine analogue cytenamide with HCl generated in methanol.
Resumo:
The structure of single wall peptide nanotubes is presented for the model surfactant-like peptide A6K. Capillary flow alignment of a sample in the nematic phase at high concentration in water leads to oriented X-ray diffraction patterns. Analysis of these, accompanied by molecular dynamics simulations, suggests the favourable self-assembly of antiparallel peptide dimers into beta-sheet ribbons that wrap helically to form the nanotube wall.
Resumo:
The complex [(C(NH2)3)3ZrOH(CO3)3·H2O]2 (A) has been shown by means of a single crystal X-ray diffraction study to contain [C(NH2)3]+ cations and dimeric anions of formulation [(ZrOH(CO3)3)2]6−. The anion is centrosymmetric with each metal being bonded to two bridging OH groups and three chelating CO2−3 ions. The Zr atoms are thus eight coordinate with a dodecahedral environments. The ZrO distances formed by the bridgng OH groups are shorter than those formed through zirconiu carbonate interactions. The non-bonded Zr…Zr distance is 3.47(2) Å. An infrared spectroscopic investigation of A provides data which support the findings of the crystallographic study. Likewise the complex Na6(ZrOH(CO2O4)3)2·7H2O (B) contains the anion [(ZrOH(C2O4)3)2]6−. This anion is structurally related to the anion in A as each Zr atom has an eight-coordinate dodecahedral environment being bonded to two bridging OH groups and three chelating oxalate ligands, but has no imposed crysallographic symmetry. The Zr…Zr non-bonded distance is 3.50(1) Å. The OZrO bridge angles are 69.7(4)° and A and 67.4(3)° in B.
Resumo:
Gallaborane (GaBH6, 1), synthesized by the metathesis of LiBH4 with [H2GaCl]n at ca. 250 K, has been characterized by chemical analysis and by its IR and 1H and 11B NMR spectra. The IR spectrum of the vapor at low pressure implies the presence of only one species, viz. H2Ga(μ-H)2BH2, with a diborane-like structure conforming to C2v symmetry. The structure of this molecule has been determined by gas-phase electron diffraction (GED) measurements afforced by the results of ab initio molecular orbital calculations. Hence the principal distances (rα in Å) and angles ( α in deg) are as follows: r(Ga•••B), 2.197(3); r(Ga−Ht), 1.555(6); r(Ga−Hb), 1.800(6); r(B−Ht), 1.189(7); r(B−Hb), 1.286(7); Hb−Ga−Hb, 71.6(4); and Hb−B−Hb, 110.0(5) (t = terminal, b = bridging). Aggregation of the molecules occurs in the condensed phases. X-ray crystallographic studies of a single crystal at 110 K reveal a polymeric network with helical chains made up of alternating pseudotetrahedral GaH4 and BH4 units linked through single hydrogen bridges; the average Ga•••B distance is now 2.473(7) Å. The compound decomposes in the condensed phases at temperatures exceeding ca. 240 K with the formation of elemental Ga and H2 and B2H6. The reactions with NH3, Me3N, and Me3P are also described.
Resumo:
The structures of benzoic acid (C6H5COOH) and 2-hydroxybenzoic acid (C6H4OHCOOH) have been determined in the gas phase by electron diffraction using results from quantum chemical calculations to inform restraints used on the structural parameters. Theoretical methods (HF and MP2/6-311+G(d, p)) predict two conformers for benzoic acid, one which is 25.0 kJ mol(-1) (MP2) lower in energy than the other. In the low-energy form, the carboxyl group is coplanar with the phenyl ring and the O-H group eclipses the C=O bond. Theoretical calculations (HF and MP2/6-311+ G(d, p)) carried out for 2-hydroxybenzoic acid gave evidence for seven stable conformers but one low-energy form (11.7 kJ mol-1 lower in energy (MP2)) which again has the carboxyl group coplanar with the phenyl ring, the O-H of the carboxyl group eclipsing the C=O bond and the C=O of the carboxyl group oriented toward the O-H group of the phenyl ring. The effects of internal hydrogen bonding in 2-hydroxybenzoic acid can be clearly observed by comparison of pertinent structural parameters between the two compounds. These differences for 2-hydroxybenzoic acid include a shorter exocyclic C-C bond, a lengthening of the ring C-C bond between the substituents, and a shortening of the carboxylic single C-O bond.
Resumo:
Polycondensation of 2,6-dihydroxynaphthalene with 4,4'-bis(4"-fluorobenzoyl)biphenyl affords a novel, semicrystalline poly(ether ketone) with a melting point of 406 degreesC and glass transition temperature (onset) of 168 degreesC. Molecular modeling and diffraction-simulation studies of this polymer, coupled with data from the single-crystal structure of an oligomer model, have enabled the crystal and molecular structure of the polymer to be determined from X-ray powder data. This structure-the first for any naphthalene-containing poly(ether ketone)-is fully ordered, in monoclinic space group P2(1)/b, with two chains per unit cell. Rietveld refinement against the experimental powder data gave a final agreement factor (R-wp) of 6.7%.
Resumo:
The compounds chlorothiazide and hydrochlorothiazide (crystalline form II) have been studied in their fully hydrogenous forms by powder neutron diffraction on the GEM diffractometer. The results of joint Rietveld refinement of the structures against multi-bank neutron and single-bank X-ray powder data are reported and show that accurate and precise structural information can be obtained from polycrystalline molecular organic materials by this route.
Resumo:
Differential thermal expansion over the range 90-210 K has been applied successfully to determine the crystal structure of chlorothiazide from synchrotron powder diffraction data using direct methods. Key to the success of the approach is the use of a multi-data-set Pawley refinement to extract a set of reflection intensities that is more 'single-crystal-like' than those extracted from a single data set. The improvement in reflection intensity estimates is quantified by comparison with reference single-crystal intensities. (C) 2008 International Union of Crystallography Printed in Singapore - all rights reserved
Resumo:
Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.
Resumo:
The ability to display and inspect powder diffraction data quickly and efficiently is a central part of the data analysis process. Whilst many computer programs are capable of displaying powder data, their focus is typically on advanced operations such as structure solution or Rietveld refinement. This article describes a lightweight software package, Jpowder, whose focus is fast and convenient visualization and comparison of powder data sets in a variety of formats from computers with network access. Jpowder is written in Java and uses its associated Web Start technology to allow ‘single-click deployment’ from a web page, http://www.jpowder.org. Jpowder is open source, free and available for use by anyone.
Resumo:
In this paper we derive novel approximations to trapped waves in a two-dimensional acoustic waveguide whose walls vary slowly along the guide, and at which either Dirichlet (sound-soft) or Neumann (sound-hard) conditions are imposed. The guide contains a single smoothly bulging region of arbitrary amplitude, but is otherwise straight, and the modes are trapped within this localised increase in width. Using a similar approach to that in Rienstra (2003), a WKBJ-type expansion yields an approximate expression for the modes which can be present, which display either propagating or evanescent behaviour; matched asymptotic expansions are then used to derive connection formulae which bridge the gap across the cut-off between propagating and evanescent solutions in a tapering waveguide. A uniform expansion is then determined, and it is shown that appropriate zeros of this expansion correspond to trapped mode wavenumbers; the trapped modes themselves are then approximated by the uniform expansion. Numerical results determined via a standard iterative method are then compared to results of the full linear problem calculated using a spectral method, and the two are shown to be in excellent agreement, even when $\epsilon$, the parameter characterising the slow variations of the guide’s walls, is relatively large.