44 resultados para Shirley, William, 1694-1771.
em CentAUR: Central Archive University of Reading - UK
Resumo:
Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.
Resumo:
This essay examines aspects of the serialisation of the novels of William Clark Russell, the greatest late Victorian nautical novelist. Focusing on the treatment of his work by the Edinburgh firm of Messrs Chambers, the article provides an illuminating perspective on market censorship in this period. Drawing on the archives of Chatto & Windus and the literary agent A.P. Watt, it traces the network of relations between author, agent, magazine editor and book publisher, showing how the various components of the serial market operated in the late 1880s and early 1890s.