The effectiveness of assessment learning objects produced using pair programming

Pair Programming is a technique from the software development method eXtreme Programming (XP) whereby two programmers work closely together to develop a piece of software. A similar approach has been used to develop a set of Assessment Learning Objects (ALO). Three members of academic staff have developed a set of ALOs for a total of three different modules (two with overlapping content). In each case a pair programming approach was taken to the development of the ALO. In addition to demonstrating the efficiency of this approach in terms of staff time spent developing the ALOs, a statistical analysis of the outcomes for students who made use of the ALOs is used to demonstrate the effectiveness of the ALOs produced via this method.

Collaborative eLearning Assistant Network: caring agents are conscious agents

Would a research assistant - who can search for ideas related to those you are working on, network with others (but only share the things you have chosen to share), doesn’t need coffee and who might even, one day, appear to be conscious - help you get your work done? Would it help your students learn? There is a body of work showing that digital learning assistants can be a benefit to learners. It has been suggested that adaptive, caring, agents are more beneficial. Would a conscious agent be more caring, more adaptive, and better able to deal with changes in its learning partner’s life? Allow the system to try to dynamically model the user, so that it can make predictions about what is needed next, and how effective a particular intervention will be. Now, given that the system is essentially doing the same things as the user, why don’t we design the system so that it can try to model itself in the same way? This should mimic a primitive self-awareness. People develop their personalities, their identities, through interacting with others. It takes years for a human to develop a full sense of self. Nobody should expect a prototypical conscious computer system to be able to develop any faster than that. How can we provide a computer system with enough social contact to enable it to learn about itself and others? We can make it part of a network. Not just chatting with other computers about computer ‘stuff’, but involved in real human activity. Exposed to ‘raw meaning’ – the developing folksonomies coming out of the learning activities of humans, whether they are traditional students or lifelong learners (a term which should encompass everyone). Humans have complex psyches, comprised of multiple strands of identity which reflect as different roles in the communities of which they are part – so why not design our system the same way? With multiple internal modes of operation, each capable of being reflected onto the outside world in the form of roles – as a mentor, a research assistant, maybe even as a friend. But in order to be able to work with a human for long enough to be able to have a chance of developing the sort of rich behaviours we associate with people, the system needs to be able to function in a practical and helpful role. Unfortunately, it is unlikely to get a free ride from many people (other than its developer!) – so it needs to be able to perform a useful role, and do so securely, respecting the privacy of its partner. Can we create a system which learns to be more human whilst helping people learn?

Facebook & Blackboard: comparison of learner perspectives

Different systems, different purposes – but how do they compare as learning environments? We undertook a survey of students at the University, asking whether they learned from their use of the systems, whether they made contact with other students through them, and how often they used them. Although it was a small scale survey, the results are quite enlightening and quite surprising. Blackboard is populated with learning material, has all the students on a module signed up to it, a safe environment (in terms of Acceptable Use and some degree of staff monitoring) and provides privacy within the learning group (plus lecturer and relevant support staff). Facebook, on the other hand, has no learning material, only some of the students using the system, and on the face of it, it has the opportunity for slips in privacy and potential bullying because the Acceptable Use policy is more lax than an institutional one, and breaches must be dealt with on an exception basis, when reported. So why do more students find people on their courses through Facebook than Blackboard? And why are up to 50% of students reporting that they have learned from using Facebook? Interviews indicate that students in subjects which use seminars are using Facebook to facilitate working groups – they can set up private groups which give them privacy to discuss ideas in an environment which perceived as safer than Blackboard can provide. No staff interference, unless they choose to invite them in, and the opportunity to select who in the class can engage. The other striking finding is the difference in use between the genders. Males are using blackboard more frequently than females, whilst the reverse is true for Facebook. Interviews suggest that this may have something to do with needing to access lecture notes… Overall, though, it appears that there is little relationship between the time spent engaging with Blackboard and reports that students have learned from it. Because Blackboard is our central repository for notes, any contact is likely to result in some learning. Facebook, however, shows a clear relationship between frequency of use and perception of learning – and our students post frequently to Facebook. Whilst much of this is probably trivia and social chit chat, the educational elements of it are, de facto, contructivist in nature. Further questions need to be answered - Is the reason the students learn from Facebook because they are creating content which others will see and comment on? Is it because they can engage in a dialogue, without the risk of interruption by others?

An ontological approach to competency management

Competency management is a very important part of a well-functioning organisation. Unfortunately competency descriptions are not uniformly specified nor defined across borders: National, sectorial or organisational, leading to an opaque competency description market with a multitude of competency frameworks and competency benchmarks. An ontology is a formalised description of a domain, which enables automated reasoning engines to be built which by utilising the interrelations between entities can make “intelligent” choices in different situations within the domain. Introducing formalised competency ontologies automated tools, such as skill gap analysis, training suggestion generation, job search and recruitment, can be developed, which compare and contrast different competency descriptions on the semantic level. The major problem with defining a common formalised ontology for competencies is that there are so many viewpoints of competencies and competency frameworks. Work within the TRACE project has focused on finding common trends within different competency frameworks in order to allow an intermediate competency description to be made, which other frameworks can reference. This research has shown that competencies can be divided up into “knowledge”, “skills” and what we call “others”. An ontology has been created based on this with a simple structure of different “kinds” of “knowledges” and “skills” using semantic interrelations to define the basic semantic structure of the ontology. A prototype tool for analysing a skill gap analysis has been developed. Personal profiles can be produced using the tool and a skill gap analysis is performed on a desired competency profile by using an ontologically based inference engine, which is able to list closest fit and possible proficiency gaps

Facebook & BlackBoard: comparative view of learning environments

For several years, online educational tools such as Blackboard have been used by Universities to foster collaborative learning in an online setting. Such tools tend to be implemented in a top-down fashion, with the institution providing the tool to the students and instructing them to use it. Recently, however, a more informal, bottom up approach is increasingly being employed by the students themselves in the form of social networks such as Facebook. With over 9,000 registered Facebook users at the beginning of this study, rising to over 12,000 at the University of Reading alone, Facebook is becoming the de facto social network of choice for higher education students in the UK, and there was increasing anecdotal evidence that students were actively learning via Facebook rather than through BlackBoard. To test the validity of these anecdotes, a questionnaire was sent to students, asking them about their learning experiences via BlackBoard and Facebook. The results show that students are making use of the tools available to them even when there is no formal academic content, and that increased use of a social networking tool is correlated with a reported increase in learning as a result of that use.

Cost-benefit analysis model of badger (Meles meles) culling to reduce cattle herd tuberculosis breakdowns in Britain, with particular reference to badger perturbation

Bovine tuberculosis (TB)is an important economic disease. Badgers (Meles meles) are the wildlife source implicated in many cattle outbreaks of TB in Britain, and extensive badger control is a controversial option to reduce the disease. A badger and cattle population model was developed, simulating TB epidemiology; badger ecology, including postcull social perturbation; and TB-related farm management. An economic cost-benefit module was integrated into the model to assess whether badger control offers economic benefits. Model results strongly indicate that although, if perturbation were restricted, extensive badger culling could reduce rates in cattle, overall an economic loss would be more likely than a benefit. Perturbation of the badger population was a key factor determining success or failure of control. The model highlighted some important knowledge gaps regarding both the spatial and temporal characteristics of perturbation that warrant further research.

Future directions for child anxiety theory and treatment

The aim of this introductory paper, and of this special issue of Cognition and Emotion, is to stimulate debate about theoretical issues that will inform child anxiety research in the coming years. Papers included in this special issue have arisen from an Economic and Social Research Council (ESRC, UK) funded seminar series, which we called Child Anxiety Theory and Treatment (CATTS). We begin with an overview of the CATTS project before discussing (1) the application of adult models of anxiety to children, and (2) the role of parents in child anxiety. We explore the utility of adult models of anxiety for child populations before discussing the problems that are associated with employing them uncritically in this context. The study of anxiety in children provides the opportunity to observe the trajectory of anxiety and to identify variables that causally influence its development. Parental influences are of particular interest and new and imaginative strategies are required to isolate the complex network of causal relationships therein. We conclude by suggesting that research into the causes and developmental course of anxiety in children should be developed further. We also propose that, although much is known about the role of parents in the development of anxiety, it would be useful for research in this area to move towards an examination of the specific processes involved. We hope that these views represent a constructive agenda for people in the field to consider when planning future research.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Understanding your digital identity

The term “Digital Identity” is used here to describe the persona a person projects across the internet. Your Digital Identity as perceived by other people is made up of material that you post yourself (for example photographs on Flickr and your own web page) but it also is made up of material other people put there about you (blog posts that mention you, photographs in which you are tagged). The “This is Me” project has developed resources that can be used by students and others to appreciate what their Digital Identity is and how they can control it to help present the persona with the reputation that they want.

Digital identity for the retired

A This Is Me workbook for the retired or vulnerable internet user.

Position paper on the future of social networking

Social networking mediated by web sites is a relatively new phenomenon and as with all technological innovations there continues to be a period of both technical and social adjustment to fit the services in with people’s behaviours, and for people to adjust their practices in the light of the affordances provided by the technology. Social networking benefits strongly from large scale availability. Users gain greater benefit from social networking services when more of their friends are using them.This applies in social terms, but also in eLearning and professional networks. The network effect provides one explanation for the popularity of internet based social networking sites (SNS) because the number of connections between people which can be maintained by using them is greatly increased in comparison to the networks available before the internet. The ability of users to determine how much they trust information available to them from contacts within their social network is important in almost all modes of use. As sources of information on a range of topics from academic to shopping advice, the level of trust which a user can put in other nodes is a key aspect of the utility of the system.