GODIVA2: interactive visualization of environmental data on the Web

GODIVA2 is a dynamic website that provides visual access to several terabytes of physically distributed, four-dimensional environmental data. It allows users to explore large datasets interactively without the need to install new software or download and understand complex data. Through the use of open international standards, GODIVA2 maintains a high level of interoperability with third-party systems, allowing diverse datasets to be mutually compared. Scientists can use the system to search for features in large datasets and to diagnose the output from numerical simulations and data processing algorithms. Data providers around Europe have adopted GODIVA2 as an INSPIRE-compliant dynamic quick-view system for providing visual access to their data.

Mass and size distribution measurement of particulates from a gas turbine combustor using modern mobility analyzer and particle sizer

SMPS and DMS500 analysers were used to measure particulate size distributions in the exhaust of a fully annular aero gas turbine engine at two operating conditions to compare and analyse sources of discrepancy. A number of different dilution ratio values were utilised for the comparative analysis, and a Dekati hot diluter operating at a temperature of 623°K was also utilised to remove volatile PM prior to measurements being made. Additional work focused on observing the effect of varying the sample line temperatures to ascertain the impact. Explanations are offered for most of the trends observed, although a new, repeatable event identified in the range from 417°K to 423°K – where there was a three order of magnitude increase in the nucleation mode of the sample – requires further study.

"To strive for economic and social justice": welfare, sexuality, and party politics in San Francisco in the 1960s

This article explores how liberal politicians like Phil Burton of San Francisco joined with welfare rights lobbyists and bureaucrats to embrace late twntieth-century notions of sexual equality through a broader reconception of economic equality brought about by the expansion of the California welfare state in the early 1960s.

Tree Inscriptions: restoring a lost facet of the Graeco-Roman epigraphic habit

This article for the first time considers all extant ancient evidence for the habit of carving inscriptions on tree trunks. It emerges a picture that bears remarkable resemblances to what is known from the habit of graffiti writing (with important addition to that latter field to be derived from the findings), for individual and technical texts.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Design and development of a haptic dental training system - hapTEL

This paper presents a novel design of a virtual dental training system (hapTEL) using haptic technology. The system allows dental students to learn and practice procedures such as dental drilling, caries removal and cavity preparation for tooth restoration. This paper focuses on the hardware design, development and evaluation aspects in relation to the dental training and educational requirements. Detailed discussions on how the system offers dental students a natural operational position are documented. An innovative design of measuring and connecting the dental tools to the haptic device is also shown. Evaluation of the impact on teaching and learning is discussed.

Short tandem repeat profiling provides an international reference standard for human cell lines

Cross-contamination between cell lines is a longstanding and frequent cause of scientific misrepresentation. Estimates from national testing services indicate that up to 36% of cell lines are of a different origin or species to that claimed. To test a standard method of cell line authentication, 253 human cell lines from banks and research institutes worldwide were analyzed by short tandem repeat profiling. The short tandem repeat profile is a simple numerical code that is reproducible between laboratories, is inexpensive, and can provide an international reference standard for every cell line. If DNA profiling of cell lines is accepted and demanded internationally, scientific misrepresentation because of cross-contamination can be largely eliminated.

Methods for kinematic modeling of biological and robotic systems

The main objective is to develop methods that automatically generate kinematic models for the movements of biological and robotic systems. Two methods for the identification of the kinematics are presented. The first method requires the elimination of the displacement variables that cannot be measured while the second method attempts to estimate the changes in these variables. The methods were tested using a planar two-revolute-joint linkage. Results show that the model parameters obtained agree with the actual parameters to within 5%. Moreover, the methods were applied to model head and neck movements in the sagittal plane. The results indicate that these movements are well modeled by a two-revolute-joint system. A spatial three-revolute-joint model was also discussed and tested.

A novel scheme for human-friendly and time-delays robust neuropredictive teleoperation

A novel Neuropredictive Teleoperation (NPT) Scheme is presented. The design results from two key ideas: the exploitation of the measured or estimated neural input to the human arm or its electromyograph (EMG) as the system input and the employment of a predictor of the arm movement, based on this neural signal and an arm model, to compensate for time delays in the system. Although a multitude of such models, as well as measuring devices for the neural signals and the EMG, have been proposed, current telemanipulator research has only been considering highly simplified arm models. In the present design, the bilateral constraint that the master and slave are simultaneously compliant to each other's state (equal positions and forces) is abandoned, thus obtaining a simple to analyzesuccession of only locally controlled modules, and a robustness to time delays of up to 500 ms. The proposed designs were inspired by well established physiological evidence that the brain, rather than controlling the movement on-line, programs the arm with an action plan of a complete movement, which is then executed largely in open loop, regulated only by local reflex loops. As a model of the human arm the well-established Stark model is employed, whose mathematical representation is modified to make it suitable for an engineering application. The proposed scheme is however valid for any arm model. BIBO-stability and passivity results for a variety of local control laws are reported. Simulation results and comparisons with traditional designs also highlight the advantages of the proposed design.

Kinematic modeling of head-neck movements

The main objective is to generate kinematic models for the head and neck movements. The motivation comes from our study of individuals with quadriplegia and the need to design rehabilitation aiding devices such as robots and teletheses that can be controlled by head-neck movements. It is then necessary to develop mathematical models for the head and neck movements. Two identification methods have been applied to study the kinematics of head-neck movements of able-body as well as neck-injured subjects. In particular, sagittal plane movements are well modeled by a planar two-revolute-joint linkage. In fact, the motion in joint space seems to indicate that sagittal plane movements may be classified as a single DOF motion. Finally, a spatial three-revolute-joint system has been employed to model 3D head-neck movements.

Enhancement of a telemanipulator design with a human arm model

In this chapter we described how the inclusion of a model of a human arm, combined with the measurement of its neural input and a predictor, can provide to a previously proposed teleoperator design robustness under time delay. Our trials gave clear indications of the superiority of the NPT scheme over traditional as well as the modified Yokokohji and Yoshikawa architectures. Its fundamental advantages are: the time-lead of the slave, the more efficient, and providing a more natural feeling manipulation, and the fact that incorporating an operator arm model leads to more credible stability results. Finally, its simplicity allows less likely to fail local control techniques to be employed. However, a significant advantage for the enhanced Yokokohji and Yoshikawa architecture results from the very fact that it’s a conservative modification of current designs. Under large prediction errors, it can provide robustness through directing the master and slave states to their means and, since it relies on the passivity of the mechanical part of the system, it would not confuse the operator. An experimental implementation of the techniques will provide further evidence for the performance of the proposed architectures. The employment of neural networks and fuzzy logic, which will provide an adaptive model of the human arm and robustifying control terms, is scheduled for the near future.