28 resultados para SAMPLE PREPARATION

em CentAUR: Central Archive University of Reading - UK


Relevância:

100.00% 100.00%

Publicador:

Resumo:

Evidence is presented that the performance of the rationally designed MALDI matrix 4-chloro-α-cyanocinnamic acid (ClCCA) in comparison to its well-established predecessor α-cyano-4-hydroxycinnamic acid (CHCA) is significantly dependent on the sample preparation, such as the choice of the target plate. In this context, it becomes clear that any rational designs of MALDI matrices and their successful employment have to consider a larger set of physicochemical parameters, including sample crystallization and morphology/topology, in addition to parameters of basic (solution and/or gas-phase) chemistry.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Inductively coupled plasma mass spectrometry (ICP-MS) was used to investigate changes in trace element concentration in two high resolution sequences of tree rings from central Sweden. Individual annual growth increments from 18002002 to 1930-2002 were sampled from two Scots pine (Pinus sylvestris) trees from the Siljansfors Experimental Forest. The aims of the study were: to test the viability of conventional solution induction ICP-MS as a technique for investigating the multi-elemental chemistry of long tree ring sequences at annual resolution, and, to test this specifically with a view to detecting changes in elemental concentrations of Swedish tree rings contemporary with the major (and relatively proximal) Icelandic eruption of Askja (1875). It was found that despite a time consuming sample preparation process, it was possible to use conventional ICP-MS for multi-elemental analysis of a long sequence of tree rings at annual resolution. Although promising data were produced, no truly conclusive concentration anomaly could be detected in the sequence to indicate the impact of the Askja eruption on environmental chemistry. Overall findings underlined the complexity of the tree/environment interaction and the cautious approach to data interpretation essential for any dendrochemical study. (c) 2006 Elsevier Ltd. All rights reserved.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Stable isotopic characterization of chlorine in chlorinated aliphatic pollution is potentially very valuable for risk assessment and monitoring remediation or natural attenuation. The approach has been underused because of the complexity of analysis and the time it takes. We have developed a new method that eliminates sample preparation. Gas chromatography produces individually eluted sample peaks for analysis. The He carrier gas is mixed with Ar and introduced directly into the torch of a multicollector ICPMS. The MC-ICPMS is run at a high mass resolution of >= 10 000 to eliminate interference of mass 37 ArH with Cl. The standardization approach is similar to that for continuous flow stable isotope analysis in which sample and reference materials are measured successively. We have measured PCE relative to a laboratory TCE standard mixed with the sample. Solvent samples of 200 nmol to 1.3 mu mol ( 24- 165 mu g of Cl) were measured. The PCE gave the same value relative to the TCE as measured by the conventional method with a precision of 0.12% ( 2 x standard error) but poorer precision for the smaller samples.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Matrix-assisted laser desorption/ionization (MALDI) is a key ionization technique in mass spectrometry (MS) for the analysis of labile macromolecules. An important area of study and improvements in relation to MALDI and its application in high-sensitivity MS is that of matrix design and sample preparation. Recently, 4-chloro-alpha-cyanocinnamic acid (ClCCA) has been introduced as a new rationally designed matrix and reported to provide an improved analytical performance as demonstrated by an increase in sequence coverage of protein digests obtained by peptide mass mapping (PMM) (Jaskolla, T. W.; et al. Proc. Natl. Acad. Sci. U.S.A. 2008, 105, 12200-12205). This new matrix shows the potential to be a superior alternative to the commonly used and highly successful alpha-cyano-4-hydroxycinnamic acid (CHCA). We have taken this design one step further by developing and optimizing an ionic liquid matrix (ILM) and liquid support matrix (LSM) using ClCCA as the principle chromophore and MALDI matrix compound. These new liquid matrices possess greater sample homogeneity and a simpler morphology. The data obtained from our studies show improved sequence coverage for BSA digests compared to the traditional CHCA crystalline matrix and for the ClCCA-containing ILM a similar performance to the ClCCA crystalline matrix down to 1 fmol of BSA digest prepared in a single MALDI sample droplet with current sensitivity levels in the attomole range. The LSMs show a high tolerance to contamination such as ammonium bicarbonate, a commonly used buffering agent.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Maize silage nutritive quality is routinely determined by near infrared reflectance spectroscopy (NIRS). However, little is known about the impact of sample preparation on the accuracy of the calibration to predict biological traits. A sample population of 48 maize silages representing a wide range of physiological maturities was used in a study to determine the impact of different sample preparation procedures (i.e., drying regimes; the presence or absence of residual moisture; the degree of particle comminution) on resultant NIR prediction statistics. All silages were scanned using a total of 12 combinations of sample pre-treatments. Each sample preparation combination was subjected to three multivariate regression techniques to give a total of 36 predictions per biological trait. Increased sample preparations procedure, relative to scanning the unprocessed whole plant (WP) material, always resulted in a numerical minimisation of model statistics. However, the ability of each of the treatments to significantly minimise the model statistics differed. Particle comminution was the most important factor, oven-drying regime was intermediate, and residual moisture presence was the least important. Models to predict various biological parameters of maize silage will be improved if material is subjected to a high degree of particle comminution (i.e., having been passed through a 1 mm screen) and developed on plant material previously dried at 60 degrees C. The extra effort in terms of time and cost required to remove sample residual moisture cannot be justified. (c) 2005 Elsevier B.V. All rights reserved.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Methodology used to measure in vitro gas production is reviewed to determine impacts of sources of variation on resultant gas production profiles (GPP). Current methods include measurement of gas production at constant pressure (e.g., use of gas tight syringes), a system that is inexpensive, but may be less sensitive than others thereby affecting its suitability in some situations. Automated systems that measure gas production at constant volume allow pressure to accumulate in the bottle, which is recorded at different times to produce a GPP, and may result in sufficiently high pressure that solubility of evolved gases in the medium is affected, thereby resulting in a recorded volume of gas that is lower than that predicted from stoichiometric calculations. Several other methods measure gas production at constant pressure and volume with either pressure transducers or sensors, and these may be manual, semi-automated or fully automated in operation. In these systems, gas is released as pressure increases, and vented gas is recorded. Agitating the medium does not consistently produce more gas with automated systems, and little or no effect of agitation was observed with manual systems. The apparatus affects GPP, but mathematical manipulation may enable effects of apparatus to be removed. The amount of substrate affects the volume of gas produced, but not rate of gas production, provided there is sufficient buffering capacity in the medium. Systems that use a very small amount of substrate are prone to experimental error in sample weighing. Effect of sample preparation on GPP has been found to be important, but further research is required to determine the optimum preparation that mimics animal chewing. Inoculum is the single largest source of variation in measuring GPP, as rumen fluid is variable and sampling schedules, diets fed to donor animals and ratios of rumen fluid/medium must be selected such that microbial activity is sufficiently high that it does not affect rate and extent of fermentation. Species of donor animal may also cause differences in GPP. End point measures can be mathematically manipulated to account for species differences, but rates of fermentation are not related. Other sources of inocula that have been used include caecal fluid (primarily for investigating hindgut fermentation in monogastrics), effluent from simulated rumen fermentation (e.g., 'Rusitec', which was as variable as rumen fluid), faeces, and frozen or freeze-dried rumen fluid (which were both less active than fresh rumen fluid). Use of mixtures of cell-free enzymes, or pure cultures of bacteria, may be a way of increasing GPP reproducibility, while reducing reliance on surgically modified animals. However, more research is required to develop these inocula. A number of media have been developed which buffer the incubation and provide relevant micro-nutrients to the microorganisms. To date, little research has been completed on relationships between the composition of the medium and measured GPP. However, comparing GPP from media either rich in N or N-free, allows assessment of contributions of N containing compounds in the sample. (c) 2005 Published by Elsevier B.V.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

One of the major factors contributing to the failure of new wheat varieties is seasonal variability in end-use quality. Consequently, it is important to produce varieties which are robust and stable over a range of environmental conditions. Recently developed sample preparation methods have allowed the application of FT-IR spectroscopic imaging methods to the analysis of wheat endosperm cell wall composition, allowing the spatial distribution of structural components to be determined without the limitations of conventional chemical analysis. The advantages of the methods, described in this paper, are that they determine the composition of endosperm cell walls in situ and with minimal modification during preparation. Two bread-making wheat cultivars, Spark and Rialto, were selected to determine the impact of environmental conditions on the cell-wall composition of the starchy endosperm of the developing and mature grain, focusing on the period of grain filling (starting at about 14 days after anthesis). Studies carried out over two successive seasons show that the structure of the arabinoxylans in the endosperm cell walls changes from a highly branched form to a less branched form. Furthermore, during development the rate of restructuring was faster when the plants were grown at higher temperature with restricted water availability from 14 days after anthesis with differences in the rate of restructuring occurring between the two cultivars.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Intact, enveloped coronavirus particles vary widely in size and contour, and are thus refractory to study by traditional structural means such as X-ray crystallography. Electron microscopy (EM) overcomes some problems associated with particle variability and has been an important tool for investigating coronavirus ultrastructure. However, EM sample preparation requires that the specimen be dried onto a carbon support film before imaging, collapsing internal particle structure in the case of coronaviruses. Moreover, conventional EM achieves image contrast by immersing the specimen briefly in heavy-metal-containing stain, which reveals some features while obscuring others. Electron cryomicroscopy (cryo-EM) instead employs a porous support film, to which the specimen is adsorbed and flash-frozen. Specimens preserved in vitreous ice over holes in the support film can then be imaged without additional staining. Cryo-EM, coupled with single-particle image analysis techniques, makes it possible to examine the size, structure and arrangement of coronavirus structural components in fully hydrated, native virions. Two virus purification procedures are described.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

We have combined several key sample preparation steps for the use of a liquid matrix system to provide high analytical sensitivity in automated ultraviolet -- matrix-assisted laser desorption/ionisation -- mass spectrometry (UV-MALDI-MS). This new sample preparation protocol employs a matrix-mixture which is based on the glycerol matrix-mixture described by Sze et al. The low-femtomole sensitivity that is achievable with this new preparation protocol enables proteomic analysis of protein digests comparable to solid-state matrix systems. For automated data acquisition and analysis, the MALDI performance of this liquid matrix surpasses the conventional solid-state MALDI matrices. Besides the inherent general advantages of liquid samples for automated sample preparation and data acquisition the use of the presented liquid matrix significantly reduces the extent of unspecific ion signals in peptide mass fingerprints compared to typically used solid matrices, such as 2,5-dihydroxybenzoic acid (DHB) or alpha-cyano-hydroxycinnamic acid (CHCA). In particular, matrix and low-mass ion signals and ion signals resulting from cation adduct formation are dramatically reduced. Consequently, the confidence level of protein identification by peptide mass mapping of in-solution and in-gel digests is generally higher.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Matrix-assisted laser desorption/ionization (MALDI) is a key technique in mass spectrometry (MS)-based proteomics. MALDI MS is extremely sensitive, easy-to-apply, and relatively tolerant to contaminants. Its high-speed data acquisition and large-scale, off-line sample preparation has made it once again the focus for high-throughput proteomic analyses. These and other unique properties of MALDI offer new possibilities in applications such as rapid molecular profiling and imaging by MS. Proteomics and its employment in Systems Biology and other areas that require sensitive and high-throughput bioanalytical techniques greatly depend on these methodologies. This chapter provides a basic introduction to the MALDI methodology and its general application in proteomic research. It describes the basic MALDI sample preparation steps and two easy-to-follow examples for protein identification including extensive notes on these topics with practical tips that are often not available in the Subheadings 2 and 3 of research articles.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

We have combined several key sample preparation steps for the use of a liquid matrix system to provide high analytical sensitivity in automated ultraviolet - matrix-assisted laser desorption/ ionisation - mass spectrometry (UV-MALDI-MS). This new sample preparation protocol employs a matrix-mixture which is based on the glycerol matrix-mixture described by Sze et al. U. Am. Soc. Mass Spectrom. 1998, 9, 166-174). The low-ferntomole sensitivity that is achievable with this new preparation protocol enables proteomic analysis of protein digests comparable to solid-state matrix systems. For automated data acquisition and analysis, the MALDI performance of this liquid matrix surpasses the conventional solid-state MALDI matrices. Besides the inherent general advantages of liquid samples for automated sample preparation and data acquisition the use of the presented liquid matrix significantly reduces the extent of unspecific ion signals in peptide mass fingerprints compared to typically used solid matrices, such as 2,5-dihydrox-ybenzoic acid (DHB) or alpha-cyano-hydroxycinnamic acid (CHCA). In particular, matrix and lowmass ion signals and ion signals resulting from cation adduct formation are dramatically reduced. Consequently, the confidence level of protein identification by peptide mass mapping of in-solution and in-gel digests is generally higher.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

This paper provides an overview of analytical techniques used to determine isoflavones (IFs) in foods and biological fluids with main emphasis on sample preparation methods. Factors influencing the content of IFs in food including processing and natural variability are summarized and an insight into IF databases is given. Comparisons of dietary intake of IFs in Asian and Western populations, in special subgroups like vegetarians, vegans, and infants are made and our knowledge on their absorption, distribution, metabolism, and excretion by the human body is presented. The influences of the gut microflora, age, gender, background diet, food matrix, and the chemical nature of the IFs on the metabolism of IFs are described. Potential mechanisms by which IFs may exert their actions are reviewed, and genetic polymorphism as determinants of biological response to soy IFs is discussed. The effects of IFs on a range of health outcomes including atherosclerosis, breast, intestinal, and prostate cancers, menopausal symptoms, bone health, and cognition are reviewed on the basis of the available in vitro, in vivo animal and human data.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Penetration enhancers are chemicals that temporarily and reversibly diminish the barrier function of the outermost layer of skin, the stratum corneum, to facilitate drug delivery to and through the tissue. In the current study, the complex mechanisms by which 1,8-cineole, a potent terpene penetration enhancer, disrupts the stratum corneum barrier is investigated using post-mortem skin samples. In order to validate the use of excised tissue for these and related studies, a fibre optical probe coupled to an FT-Raman spectrometer compared spectroscopic information for human skin recorded from in vivo and in vitro sampling arrangements. Spectra from full-thickness (epidermis and dermis) post-mortem skin samples presented to the spectrometer with minimal sample preparation (cold acetone rinse) were compared with the in vivo system (the forearms of human volunteers). No significant differences in the Raman spectra between the in vivo and in vitro samples were observed, endorsing the use of post-mortem or surgical samples for this investigational work. Treating post-mortem samples with the penetration enhancer revealed some unexpected findings: while evidence for enhancer-induced disruption of the barrier lipid packing in the stratum corneum was detected in some samples, spectra from other samples revealed an increase in lipid order on treatment with the permeation promoter. These findings are consistent with phase-separation of the enhancer within the barrier lipid domains as opposed to homogeneous disruption of the lipid lamellae. Copyright (C) 2006 John Wiley & Sons, Ltd.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.