GODIVA2: interactive visualization of environmental data on the Web

GODIVA2 is a dynamic website that provides visual access to several terabytes of physically distributed, four-dimensional environmental data. It allows users to explore large datasets interactively without the need to install new software or download and understand complex data. Through the use of open international standards, GODIVA2 maintains a high level of interoperability with third-party systems, allowing diverse datasets to be mutually compared. Scientists can use the system to search for features in large datasets and to diagnose the output from numerical simulations and data processing algorithms. Data providers around Europe have adopted GODIVA2 as an INSPIRE-compliant dynamic quick-view system for providing visual access to their data.

Mass and size distribution measurement of particulates from a gas turbine combustor using modern mobility analyzer and particle sizer

SMPS and DMS500 analysers were used to measure particulate size distributions in the exhaust of a fully annular aero gas turbine engine at two operating conditions to compare and analyse sources of discrepancy. A number of different dilution ratio values were utilised for the comparative analysis, and a Dekati hot diluter operating at a temperature of 623°K was also utilised to remove volatile PM prior to measurements being made. Additional work focused on observing the effect of varying the sample line temperatures to ascertain the impact. Explanations are offered for most of the trends observed, although a new, repeatable event identified in the range from 417°K to 423°K – where there was a three order of magnitude increase in the nucleation mode of the sample – requires further study.

"To strive for economic and social justice": welfare, sexuality, and party politics in San Francisco in the 1960s

This article explores how liberal politicians like Phil Burton of San Francisco joined with welfare rights lobbyists and bureaucrats to embrace late twntieth-century notions of sexual equality through a broader reconception of economic equality brought about by the expansion of the California welfare state in the early 1960s.

Tree Inscriptions: restoring a lost facet of the Graeco-Roman epigraphic habit

This article for the first time considers all extant ancient evidence for the habit of carving inscriptions on tree trunks. It emerges a picture that bears remarkable resemblances to what is known from the habit of graffiti writing (with important addition to that latter field to be derived from the findings), for individual and technical texts.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Short tandem repeat profiling provides an international reference standard for human cell lines

Cross-contamination between cell lines is a longstanding and frequent cause of scientific misrepresentation. Estimates from national testing services indicate that up to 36% of cell lines are of a different origin or species to that claimed. To test a standard method of cell line authentication, 253 human cell lines from banks and research institutes worldwide were analyzed by short tandem repeat profiling. The short tandem repeat profile is a simple numerical code that is reproducible between laboratories, is inexpensive, and can provide an international reference standard for every cell line. If DNA profiling of cell lines is accepted and demanded internationally, scientific misrepresentation because of cross-contamination can be largely eliminated.

The role of closed ecological systems in carbon cycle modelling

Acquiring a mechanistic understanding of the role of the biotic feedbacks on the links between atmospheric CO2 concentrations and temperature is essential for trustworthy climate predictions. Currently, computer based simulations are the only available tool to estimate the global impact of the biotic feedbacks on future atmospheric CO2 and temperatures. Here we propose an alternative and complementary approaches by using materially closed and energetically open analogue/physical models of the carbon cycle. We argue that there is potential in using a materially closed approach to improve our understanding of the magnitude and sign of many biotic feedbacks, and that recent technological advance make this feasible. We also suggest how such systems could be designed and discuss the advantages and limitations of establishing physical models of the global carbon cycle.

Intra-ovarian roles of activins and inhibins

Granulosa cells are the main ovarian source of inhibins, activins and activin-binding protein (follistatin) while germ (oogonia, oocytes) and somatic (theca, granulosa, luteal) cells express activin receptors, signaling components and inhibin co-receptor (betaglycan). Activins are implicated in various intra-ovarian roles including germ cell survival and primordial follicle assembly; follicle growth from preantral to mid-antral stages; suppression of thecal androgen production; promotion of granulosa cell proliferation, FSHR and CYP19A1 expression; enhancement of oocyte developmental competence; retardation of follicle luteinization and/or atresia and involvement in luteolysis. Inhibins (primarily inhibin A) are produced in greatest amounts by preovulatory follicles (and corpus luteum in primates) and suppress FSH secretion through endocrine negative feedback. Together with follistatin, inhibins act locally to oppose auto-/paracrine activin (and BMP) signaling thus modulating many of the above processes. The balance between activin-inhibin shifts during follicle development with activin signalling prevailing at earlier stages but declining as inhibin and betaglycan expression rise.

Granulosal and thecal expression of bone morphogenetic protein- and activin-binding protein mRNA transcripts during bovine follicle development and factors modulating their expression in vitro

Evidence supports local roles for TGFβ superfamily members including activins and bone morphogenetic proteins (BMP) in follicle development. Access of these ligands to signaling receptors is likely modulated by extracellular binding proteins (BP). In this study we compared expression of four BPs (chordin, gremlin, noggin, follistatin) in granulosal (GC) and theca interna (TC) compartments of developing bovine antral follicles (1-18mm). Effects of FSH and IGF on BMP and BP expression by cultured GC, and effects of LH and BMPs on BP expression by cultured TC were also examined. Follicular expression of all four BP transcripts was higher in GC than TC compartments (P<0.001) a finding confirmed by immunohistochemistry. Follicle category affected (P<0.01) gremlin and follistatin mRNA abundance, with a significant cell-type x follicle category interaction for chordin, follistatin and noggin. Noggin transcript abundance was lower (P<0.05) in GC of large 'E-active' than 'E-inactive' follicles while follistatin mRNA level was higher (P<0.01). FSH enhanced CYP19, FSHR, INHBA and follistatin by GC without affecting BMP or BMP-BP expression. IGF increased CYP19 and follistatin, reduced BMP4, noggin and gremlin but did not affect chordin or FSHR mRNA levels. LH increased TC androgen secretion but had no effect on BMP or BP expression. BMPs uniformly suppressed TC androgen production whilst increasing chordin, noggin, and gremlin mRNA levels up to 20-fold (P<0.01). These findings support the hypothesis that extracellular BP, mostly from GC, contribute to the regulation of intrafollicular BMP/activin signaling. Enhancement of thecal BP expression by BMP implies an autoregulatory feedback role to prevent excessive signaling.